Transcript: Human XM_011535178.2

PREDICTED: Homo sapiens ring finger protein 6 (RNF6), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF6 (6049)
Length:
1375
CDS:
631..1059

Additional Resources:

NCBI RefSeq record:
XM_011535178.2
NBCI Gene record:
RNF6 (6049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535178.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033703 GCGTCAAGGAACAACTAGCAT pLKO.1 863 CDS 100% 3.000 4.200 N RNF6 n/a
2 TRCN0000333720 GCGTCAAGGAACAACTAGCAT pLKO_005 863 CDS 100% 3.000 4.200 N RNF6 n/a
3 TRCN0000033701 GCACAGGAAATGCAACTCGAA pLKO.1 986 CDS 100% 2.640 2.112 N RNF6 n/a
4 TRCN0000333805 GCACAGGAAATGCAACTCGAA pLKO_005 986 CDS 100% 2.640 2.112 N RNF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535178.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01409 pDONR223 100% 20.2% 20% None (many diffs) n/a
2 ccsbBroad304_01409 pLX_304 0% 20.2% 20% V5 (many diffs) n/a
3 TRCN0000491933 GGATTTGAACTAAGAGAGCCATTC pLX_317 21.3% 20.2% 20% V5 (many diffs) n/a
Download CSV