Transcript: Human XM_011535303.2

PREDICTED: Homo sapiens NEDD4 binding protein 2 like 1 (N4BP2L1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
N4BP2L1 (90634)
Length:
2216
CDS:
753..1391

Additional Resources:

NCBI RefSeq record:
XM_011535303.2
NBCI Gene record:
N4BP2L1 (90634)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535303.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136426 CGGTATGAACACGATGTTACT pLKO.1 1182 CDS 100% 4.950 6.930 N N4BP2L1 n/a
2 TRCN0000136864 CCACCGAATGAAAGAACGGTA pLKO.1 1166 CDS 100% 2.640 3.696 N N4BP2L1 n/a
3 TRCN0000133717 GAAGTTATATTCCGAGAACCT pLKO.1 1074 CDS 100% 2.640 3.696 N N4BP2L1 n/a
4 TRCN0000412675 GCTCCAATTCCAGTGTAAATA pLKO_005 1475 3UTR 100% 15.000 12.000 N N4BP2L1 n/a
5 TRCN0000177658 CGCTGGAAATTCAACGTTCAA pLKO.1 1101 CDS 100% 4.950 3.960 N N4bp2l1 n/a
6 TRCN0000134699 GAAACATTCATGGTGTCTCAA pLKO.1 1135 CDS 100% 4.950 3.960 N N4BP2L1 n/a
7 TRCN0000432193 GGGCATTGCTACTTATCAAAG pLKO_005 1811 3UTR 100% 10.800 7.560 N N4BP2L1 n/a
8 TRCN0000134234 GTGGATTTACAAATGAGAGCT pLKO.1 1333 CDS 100% 2.640 1.848 N N4BP2L1 n/a
9 TRCN0000412442 ACATAGGTTCATAGATGAAAT pLKO_005 1674 3UTR 100% 13.200 7.920 N N4BP2L1 n/a
10 TRCN0000134517 GTAGACACTTTGGGAAGTTAT pLKO.1 1956 3UTR 100% 13.200 7.920 N N4BP2L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535303.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04524 pDONR223 100% 48.4% 33.4% None (many diffs) n/a
2 ccsbBroad304_04524 pLX_304 0% 48.4% 33.4% V5 (many diffs) n/a
3 TRCN0000466679 CAACCTTGGTTTGCCCGTACCTGC pLX_317 72.5% 48.4% 33.4% V5 (many diffs) n/a
Download CSV