Transcript: Human XM_011535818.3

PREDICTED: Homo sapiens lin-28 homolog B (LIN28B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LIN28B (389421)
Length:
5487
CDS:
162..938

Additional Resources:

NCBI RefSeq record:
XM_011535818.3
NBCI Gene record:
LIN28B (389421)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535818.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143619 GCCATAGTATTGGTCCTGTTA pLKO.1 2324 3UTR 100% 4.950 6.930 N LIN28B n/a
2 TRCN0000144508 CCTGTTTAGGAAGTGAAAGAA pLKO.1 502 CDS 100% 5.625 4.500 N LIN28B n/a
3 TRCN0000219859 ACTATTCATGGAAGGATTTAG pLKO.1 389 CDS 100% 13.200 9.240 N LIN28B n/a
4 TRCN0000219860 CATAACAGGTCTTCTTCATAT pLKO.1 934 CDS 100% 13.200 9.240 N LIN28B n/a
5 TRCN0000122191 GCAGGCATAATAAGCAAGTTA pLKO.1 2876 3UTR 100% 5.625 3.938 N LIN28B n/a
6 TRCN0000142983 CAAAGGGAAGACACTACAGAA pLKO.1 527 CDS 100% 4.950 3.465 N LIN28B n/a
7 TRCN0000143119 CCACTGTAAGTGGTTCAATGT pLKO.1 281 CDS 100% 4.950 3.465 N LIN28B n/a
8 TRCN0000140870 GCACCAGAAGAGCAAAGCAAA pLKO.1 882 CDS 100% 4.950 3.465 N LIN28B n/a
9 TRCN0000138995 CATCATGCACATGGTGGCAAA pLKO.1 653 CDS 100% 4.050 2.835 N LIN28B n/a
10 TRCN0000122599 GCCTTGAGTCAATACGGGTAA pLKO.1 463 CDS 100% 4.050 2.835 N LIN28B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535818.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05603 pDONR223 100% 96.5% 96.1% None 1_23del;26_27delCAinsG;31_32delCCinsGA n/a
2 ccsbBroad304_05603 pLX_304 0% 96.5% 96.1% V5 1_23del;26_27delCAinsG;31_32delCCinsGA n/a
3 TRCN0000491697 GATACGTCATTCGAAATCCTGCAG pLX_317 41.9% 96.5% 96.1% V5 1_23del;26_27delCAinsG;31_32delCCinsGA n/a
Download CSV