Transcript: Human XM_011536100.3

PREDICTED: Homo sapiens TTK protein kinase (TTK), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTK (7272)
Length:
3108
CDS:
89..2659

Additional Resources:

NCBI RefSeq record:
XM_011536100.3
NBCI Gene record:
TTK (7272)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536100.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006356 CGGTATTAACTGCCCAAGAAT pLKO.1 708 CDS 100% 5.625 7.875 N TTK n/a
2 TRCN0000352643 CGGTATTAACTGCCCAAGAAT pLKO_005 708 CDS 100% 5.625 7.875 N TTK n/a
3 TRCN0000194898 CCATAATTGATCCTAATCATG pLKO.1 2322 CDS 100% 4.950 6.930 N TTK n/a
4 TRCN0000194919 CGGAACGAAATAGCTTATTTG pLKO.1 1790 CDS 100% 13.200 10.560 N TTK n/a
5 TRCN0000006358 GCACAATTTGAACTGTCACAA pLKO.1 536 CDS 100% 4.950 3.960 N TTK n/a
6 TRCN0000342613 GCACAATTTGAACTGTCACAA pLKO_005 536 CDS 100% 4.950 3.960 N TTK n/a
7 TRCN0000195287 CGGGAACTGTTAACCAAATTA pLKO.1 234 CDS 100% 15.000 10.500 N TTK n/a
8 TRCN0000196620 GATAAGATCATCCGACTTTAT pLKO.1 1832 CDS 100% 13.200 9.240 N TTK n/a
9 TRCN0000342614 GATAAGATCATCCGACTTTAT pLKO_005 1832 CDS 100% 13.200 9.240 N TTK n/a
10 TRCN0000006357 CCAGTTGTAAAGAATGACTTT pLKO.1 1490 CDS 100% 4.950 3.465 N TTK n/a
11 TRCN0000196813 GCTAACTTTCTGATAGTTGAT pLKO.1 2036 CDS 100% 4.950 3.465 N TTK n/a
12 TRCN0000011012 GCCAACTTGTTGGTCTGAATT pLKO.1 2526 CDS 100% 0.000 0.000 N TTK n/a
13 TRCN0000342615 GCCAACTTGTTGGTCTGAATT pLKO_005 2526 CDS 100% 0.000 0.000 N TTK n/a
14 TRCN0000195128 CAAGTGAGATTTGCTGAATTA pLKO.1 425 CDS 100% 13.200 7.920 N TTK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536100.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01723 pDONR223 100% 99.8% 99.8% None 1255_1256insAGC n/a
2 ccsbBroad304_01723 pLX_304 0% 99.8% 99.8% V5 1255_1256insAGC n/a
3 TRCN0000470235 GCTTCGGACGCCATTCTTCGATTC pLX_317 17.8% 99.8% 99.8% V5 1255_1256insAGC n/a
4 ccsbBroadEn_07107 pDONR223 100% 99.8% 99.8% None 1255_1256insAGC;1578A>T;2364A>C n/a
5 ccsbBroad304_07107 pLX_304 0% 99.8% 99.8% V5 1255_1256insAGC;1578A>T;2364A>C n/a
6 TRCN0000474812 ATCATAAATCTTCATAATAGAATT pLX_317 21.9% 99.8% 99.8% V5 1255_1256insAGC;1578A>T;2364A>C n/a
7 ccsbBroadEn_14868 pDONR223 0% 99.8% 99.8% None 1255_1256insAGC;1578A>T;2364A>C n/a
8 ccsbBroad304_14868 pLX_304 0% 99.8% 99.8% V5 1255_1256insAGC;1578A>T;2364A>C n/a
9 TRCN0000473789 ACTTATTCTTTCTCCTAAAACCGC pLX_317 18.8% 99.8% 99.8% V5 1255_1256insAGC;1578A>T;2364A>C n/a
10 TRCN0000489493 TGTACGGGCGCCCAGCGATACCAG pLX_317 13.8% 99.8% 99.8% V5 (not translated due to prior stop codon) 1255_1256insAGC;1578A>T;2364A>C n/a
Download CSV