Transcript: Human XM_011536792.1

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 9 (MAP3K9), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K9 (4293)
Length:
10765
CDS:
329..2911

Additional Resources:

NCBI RefSeq record:
XM_011536792.1
NBCI Gene record:
MAP3K9 (4293)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273820 ACGACCATCTTTCACGAATAT pLKO_005 586 CDS 100% 13.200 18.480 N MAP3K9 n/a
2 TRCN0000273878 ACAACTGGAAACACGAGATTC pLKO_005 681 CDS 100% 10.800 15.120 N MAP3K9 n/a
3 TRCN0000273819 GTCCCTGGTAGATGGATATAA pLKO_005 1474 CDS 100% 15.000 10.500 N MAP3K9 n/a
4 TRCN0000021497 CCCATCAGAATCTCCACATTT pLKO.1 1438 CDS 100% 13.200 9.240 N MAP3K9 n/a
5 TRCN0000021494 CCCTACTTCTTGCACTGATAA pLKO.1 3010 3UTR 100% 13.200 9.240 N MAP3K9 n/a
6 TRCN0000021498 GATTCTGAAGATCACTGATTT pLKO.1 274 5UTR 100% 13.200 9.240 N MAP3K9 n/a
7 TRCN0000273877 TGGATATTCTGTGATTGATTT pLKO_005 3329 3UTR 100% 13.200 9.240 N MAP3K9 n/a
8 TRCN0000194909 CCTTGCTTTATGAGCCCATTA pLKO.1 4593 3UTR 100% 10.800 7.560 N MAP3K9 n/a
9 TRCN0000194928 CCTTTGGTCTTCACTCTAATC pLKO.1 3871 3UTR 100% 10.800 7.560 N MAP3K9 n/a
10 TRCN0000196575 GCGATGAAATTGTCGTGTATG pLKO.1 2157 CDS 100% 10.800 7.560 N MAP3K9 n/a
11 TRCN0000273875 GCGATGAAATTGTCGTGTATG pLKO_005 2157 CDS 100% 10.800 7.560 N MAP3K9 n/a
12 TRCN0000021496 GCGCTTCAAACGAGATCCTAA pLKO.1 2254 CDS 100% 4.950 3.465 N MAP3K9 n/a
13 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5056 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10970 pDONR223 100% 68.4% 68.4% None 0_1ins918;772_915del;1252_1293del n/a
2 ccsbBroad304_10970 pLX_304 0% 68.4% 68.4% V5 0_1ins918;772_915del;1252_1293del n/a
3 TRCN0000466870 TTCTAAGGTTTTCCACCGATTGAC pLX_317 10.3% 68.4% 68.4% V5 0_1ins918;772_915del;1252_1293del n/a
4 TRCN0000491286 CGCCGTCACCATTGCTGTGGGGGC pLX_317 11.5% 65.8% 68.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV