Transcript: Human XM_011537235.1

PREDICTED: Homo sapiens SET domain containing 3, actin histidine methyltransferase (SETD3), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SETD3 (84193)
Length:
1383
CDS:
123..1013

Additional Resources:

NCBI RefSeq record:
XM_011537235.1
NBCI Gene record:
SETD3 (84193)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122097 CTTATATTCTCAAGACCGAAT pLKO.1 545 CDS 100% 4.050 5.670 N SETD3 n/a
2 TRCN0000143148 CTTCTGTTATGACGAGGCAAA pLKO.1 868 CDS 100% 4.050 5.670 N SETD3 n/a
3 TRCN0000276530 GATGTCTTCAGCCAGTATAAA pLKO_005 735 CDS 100% 15.000 10.500 N SETD3 n/a
4 TRCN0000276580 AGATTACTTTCCTGATCTAAT pLKO_005 350 CDS 100% 13.200 9.240 N SETD3 n/a
5 TRCN0000276618 CCTGTTACATTTCCCTCTATT pLKO_005 1131 3UTR 100% 13.200 9.240 N SETD3 n/a
6 TRCN0000380754 ACTTACGGGACTCACTCATAG pLKO_005 1033 3UTR 100% 10.800 7.560 N SETD3 n/a
7 TRCN0000139106 CCTCCATTCCTTAGGCACTTA pLKO.1 1017 3UTR 100% 4.950 3.465 N SETD3 n/a
8 TRCN0000143640 GCTTTGGTTTGAGAGCAACAA pLKO.1 436 CDS 100% 4.950 3.465 N SETD3 n/a
9 TRCN0000276531 GCTTTGGTTTGAGAGCAACAA pLKO_005 436 CDS 100% 4.950 3.465 N SETD3 n/a
10 TRCN0000121628 GAAGAAGATGAAGTTCGGTAT pLKO.1 690 CDS 100% 4.050 2.835 N SETD3 n/a
11 TRCN0000285593 GAAGAAGATGAAGTTCGGTAT pLKO_005 690 CDS 100% 4.050 2.835 N SETD3 n/a
12 TRCN0000140464 GCAACTGTGTCACCAAAGGAA pLKO.1 174 CDS 100% 3.000 2.100 N SETD3 n/a
13 TRCN0000143535 GAAATCTTGAACCTGACCAGT pLKO.1 192 CDS 100% 2.640 1.584 N SETD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12791 pDONR223 100% 96.7% 96.2% None (many diffs) n/a
2 ccsbBroad304_12791 pLX_304 0% 96.7% 96.2% V5 (many diffs) n/a
3 TRCN0000469827 TGTCACCAGTCCGACCCCCCACAC pLX_317 46.3% 96.7% 96.2% V5 (many diffs) n/a
4 ccsbBroadEn_12790 pDONR223 100% 72.2% 72.2% None 1_246del n/a
5 ccsbBroad304_12790 pLX_304 0% 72.2% 72.2% V5 1_246del n/a
6 TRCN0000474620 GCGGACCCCCACCCACACATATAC pLX_317 38.6% 72.2% 72.2% V5 1_246del n/a
Download CSV