Transcript: Human XM_011538100.2

PREDICTED: Homo sapiens iron-sulfur cluster assembly enzyme (ISCU), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ISCU (23479)
Length:
3385
CDS:
1332..1721

Additional Resources:

NCBI RefSeq record:
XM_011538100.2
NBCI Gene record:
ISCU (23479)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538100.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056630 GCATGTGGTGACGTAATGAAA pLKO.1 1458 CDS 100% 5.625 4.500 N ISCU n/a
2 TRCN0000307149 GCATGTGGTGACGTAATGAAA pLKO_005 1458 CDS 100% 5.625 4.500 N ISCU n/a
3 TRCN0000056632 AGATTGTGGATGCTAGGTTTA pLKO.1 1507 CDS 100% 10.800 7.560 N ISCU n/a
4 TRCN0000290051 AGATTGTGGATGCTAGGTTTA pLKO_005 1507 CDS 100% 10.800 7.560 N ISCU n/a
5 TRCN0000056629 CCTGGCTGATTACAAATTGAA pLKO.1 2876 3UTR 100% 5.625 3.938 N ISCU n/a
6 TRCN0000290053 CCTGGCTGATTACAAATTGAA pLKO_005 2876 3UTR 100% 5.625 3.938 N ISCU n/a
7 TRCN0000056631 GTCCCTTGACAAGACATCTAA pLKO.1 1406 CDS 100% 5.625 3.938 N ISCU n/a
8 TRCN0000289988 GTCCCTTGACAAGACATCTAA pLKO_005 1406 CDS 100% 5.625 3.938 N ISCU n/a
9 TRCN0000056628 CCAGCTCATTAGCCACTGAAT pLKO.1 1558 CDS 100% 4.950 2.970 N ISCU n/a
10 TRCN0000290052 CCAGCTCATTAGCCACTGAAT pLKO_005 1558 CDS 100% 4.950 2.970 N ISCU n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538100.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15763 pDONR223 0% 69.4% 63.3% None (many diffs) n/a
2 ccsbBroad304_15763 pLX_304 0% 69.4% 63.3% V5 (many diffs) n/a
3 TRCN0000480283 AACCGTCATTTCTGCAGGACAAGA pLX_317 67.9% 69.4% 63.3% V5 (many diffs) n/a
4 ccsbBroadEn_14087 pDONR223 100% 68.7% 63.3% None (many diffs) n/a
5 ccsbBroad304_14087 pLX_304 0% 68.7% 63.3% V5 (many diffs) n/a
6 TRCN0000481175 CTTTATAGCATCCCGACGGTCCCT pLX_317 88.8% 68.7% 63.3% V5 (many diffs) n/a
Download CSV