Transcript: Human XM_011538257.2

PREDICTED: Homo sapiens keratin 73 (KRT73), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KRT73 (319101)
Length:
5890
CDS:
1610..3136

Additional Resources:

NCBI RefSeq record:
XM_011538257.2
NBCI Gene record:
KRT73 (319101)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538257.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108252 GCCCGGAGCATCTCTTTCAAT pLKO.1 1769 CDS 100% 5.625 7.875 N KRT73 n/a
2 TRCN0000108251 CGTGAGCATTTCGGTCATCAA pLKO.1 2869 CDS 100% 4.950 6.930 N KRT73 n/a
3 TRCN0000108253 CGGAGAATATACCAACTCCGT pLKO.1 2851 CDS 100% 0.066 0.092 N KRT73 n/a
4 TRCN0000428787 TTGTATAGCCACTGCATATTA pLKO_005 3611 3UTR 100% 15.000 10.500 N KRT73 n/a
5 TRCN0000429782 GGGAAAGACCTTAGCTCTAAG pLKO_005 3088 CDS 100% 10.800 7.560 N KRT73 n/a
6 TRCN0000108250 GCCTCAGTCTTTGTTAATGTT pLKO.1 3285 3UTR 100% 5.625 3.938 N KRT73 n/a
7 TRCN0000108254 GCTTCAGCAGTCGGAGCCTTT pLKO.1 1734 CDS 100% 1.350 0.945 N KRT73 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538257.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09379 pDONR223 100% 77.5% 77% None (many diffs) n/a
2 ccsbBroad304_09379 pLX_304 0% 77.5% 77% V5 (many diffs) n/a
3 TRCN0000471794 CGTGTGGTGATATAGAGAAACATC pLX_317 26.4% 77.5% 77% V5 (many diffs) n/a
4 ccsbBroadEn_13575 pDONR223 100% 63.6% 62.4% None (many diffs) n/a
5 ccsbBroad304_13575 pLX_304 0% 63.6% 62.4% V5 (many diffs) n/a
6 TRCN0000478787 CAGGTATTATTAGAGCATTGGAGC pLX_317 28% 63.6% 62.4% V5 (many diffs) n/a
Download CSV