Transcript: Human XM_011539732.1

PREDICTED: Homo sapiens hexokinase 1 (HK1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HK1 (3098)
Length:
3871
CDS:
407..3124

Additional Resources:

NCBI RefSeq record:
XM_011539732.1
NBCI Gene record:
HK1 (3098)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196596 GCGTGTGCTGTTGATAATATC pLKO.1 3291 3UTR 100% 13.200 18.480 N HK1 n/a
2 TRCN0000296844 GCGTGTGCTGTTGATAATATC pLKO_005 3291 3UTR 100% 13.200 18.480 N HK1 n/a
3 TRCN0000197140 GCACAACAATGCCGTGGTTAA pLKO.1 1879 CDS 100% 10.800 15.120 N HK1 n/a
4 TRCN0000037654 CCGATGAAACTCTCATAGATA pLKO.1 465 CDS 100% 5.625 7.875 N HK1 n/a
5 TRCN0000291063 CCGATGAAACTCTCATAGATA pLKO_005 465 CDS 100% 5.625 7.875 N HK1 n/a
6 TRCN0000037658 CGCCATTCCTATTGAAATCAT pLKO.1 2050 CDS 100% 5.625 7.875 N HK1 n/a
7 TRCN0000195210 CGATGGATCATTAGAAGACAT pLKO.1 1168 CDS 100% 4.950 6.930 N HK1 n/a
8 TRCN0000037656 CCGCAACATCTTAATCGACTT pLKO.1 2632 CDS 100% 4.050 5.670 N HK1 n/a
9 TRCN0000199971 CCTGTGAGGTTGGACTCATTG pLKO.1 2382 CDS 100% 10.800 8.640 N HK1 n/a
10 TRCN0000194999 CCACTTTGCATGGTTTGATTT pLKO.1 3342 3UTR 100% 13.200 9.240 N HK1 n/a
11 TRCN0000296770 CCACTTTGCATGGTTTGATTT pLKO_005 3342 3UTR 100% 13.200 9.240 N HK1 n/a
12 TRCN0000037655 GCCTCCACAATGCCAAAGAAA pLKO.1 1413 CDS 100% 5.625 3.938 N HK1 n/a
13 TRCN0000291064 GCCTCCACAATGCCAAAGAAA pLKO_005 1413 CDS 100% 5.625 3.938 N HK1 n/a
14 TRCN0000037657 CCTGGGAGATTTCATGGAGAA pLKO.1 769 CDS 100% 4.050 2.835 N HK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06367 pDONR223 100% 97.3% 97.2% None (many diffs) n/a
2 ccsbBroad304_06367 pLX_304 0% 97.3% 97.2% V5 (many diffs) n/a
3 TRCN0000470675 TCGCTAGCGATCTATTCATATTGA pLX_317 .5% 97.3% 97.2% V5 (many diffs) n/a
4 ccsbBroadEn_14665 pDONR223 0% 97.3% 97.2% None (many diffs) n/a
5 ccsbBroad304_14665 pLX_304 0% 97.3% 97.2% V5 (many diffs) n/a
6 TRCN0000479797 GCTTGGCTTGCGGGAATCTAGTAA pLX_317 12.7% 97.3% 97.2% V5 (many diffs) n/a
7 TRCN0000488283 CCTGTCTCTCCCGGCTGCTCGTGG pLX_317 11.8% 97.3% 97.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV