Transcript: Human XM_011539915.3

PREDICTED: Homo sapiens coiled-coil domain containing 186 (CCDC186), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC186 (55088)
Length:
6587
CDS:
351..2306

Additional Resources:

NCBI RefSeq record:
XM_011539915.3
NBCI Gene record:
CCDC186 (55088)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539915.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173167 CGAGAAGAATCAGGCACACTT pLKO.1 2025 CDS 100% 4.950 3.960 N Ccdc186 n/a
2 TRCN0000122252 CCTGTCATTGAATCTAAACAA pLKO.1 2532 3UTR 100% 5.625 3.938 N CCDC186 n/a
3 TRCN0000121939 CAGAAGTTAAAGCATTGAGTA pLKO.1 1600 CDS 100% 4.950 3.465 N CCDC186 n/a
4 TRCN0000121657 GAACAGAAATAGAACGTCTTA pLKO.1 2242 CDS 100% 4.950 3.465 N CCDC186 n/a
5 TRCN0000122439 GAGAAGAATCAGGCACACTTT pLKO.1 2026 CDS 100% 4.950 3.465 N CCDC186 n/a
6 TRCN0000121828 GCAGCATATGAACACAATTAA pLKO.1 344 5UTR 100% 0.000 0.000 N CCDC186 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3318 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3319 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539915.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03519 pDONR223 100% 72.4% 72.4% None 0_1ins741 n/a
2 ccsbBroad304_03519 pLX_304 0% 72.4% 72.4% V5 0_1ins741 n/a
3 TRCN0000473338 TTTTCCTGATGTTTTGTGGGTGTG pLX_317 18.6% 72.4% 72.4% V5 0_1ins741 n/a
Download CSV