Transcript: Human XM_011539971.2

PREDICTED: Homo sapiens N-acylsphingosine amidohydrolase 2 (ASAH2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASAH2 (56624)
Length:
4850
CDS:
201..2396

Additional Resources:

NCBI RefSeq record:
XM_011539971.2
NBCI Gene record:
ASAH2 (56624)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539971.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049515 GCTGGCACTATTGATGGAGTT pLKO.1 1572 CDS 100% 4.050 5.670 N ASAH2 n/a
2 TRCN0000049514 GCCTAGCATGTGCATTGCTAA pLKO.1 1340 CDS 100% 0.495 0.693 N ASAH2 n/a
3 TRCN0000421019 CAAAGATTTAGGAGGCCATTT pLKO_005 323 CDS 100% 10.800 7.560 N ASAH2 n/a
4 TRCN0000428597 CATCCTCACCAGGCTATACAG pLKO_005 596 CDS 100% 4.950 3.465 N ASAH2 n/a
5 TRCN0000049516 CCATCTTGTAAACAGTGACAA pLKO.1 1133 CDS 100% 4.950 3.465 N ASAH2 n/a
6 TRCN0000049513 GCATCGACATAGGCATGGTAT pLKO.1 670 CDS 100% 4.950 3.465 N ASAH2 n/a
7 TRCN0000256527 GGAAGTTGCTGAAGTTATATT pLKO_005 2060 CDS 100% 15.000 7.500 Y ASAH2B n/a
8 TRCN0000256526 CAACAGTGGAATGGCATATTC pLKO_005 2245 CDS 100% 13.200 6.600 Y ASAH2B n/a
9 TRCN0000256524 GGACTCCTGGGTCTGAGTAAT pLKO_005 2223 CDS 100% 13.200 6.600 Y ASAH2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539971.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12304 pDONR223 100% 86.7% 86.7% None (many diffs) n/a
2 ccsbBroad304_12304 pLX_304 0% 86.7% 86.7% V5 (many diffs) n/a
3 TRCN0000468873 TCTACGGTGGGGTTCCCATGCCAT pLX_317 21.2% 86.7% 86.7% V5 (many diffs) n/a
Download CSV