Transcript: Human XM_011540377.2

PREDICTED: Homo sapiens ectonucleoside triphosphate diphosphohydrolase 1 (ENTPD1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ENTPD1 (953)
Length:
12619
CDS:
531..1739

Additional Resources:

NCBI RefSeq record:
XM_011540377.2
NBCI Gene record:
ENTPD1 (953)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540377.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050291 CCCAGATAATGCTCTGCAATT pLKO.1 902 CDS 100% 10.800 15.120 N ENTPD1 n/a
2 TRCN0000257193 GCACCAAGAGACACCCGTTTA pLKO_005 566 CDS 100% 10.800 15.120 N ENTPD1 n/a
3 TRCN0000230635 CTATGAGGTAGGTGGTATATA pLKO_005 2471 3UTR 100% 15.000 10.500 N ENTPD1 n/a
4 TRCN0000363195 CCTTCTGCAAGGCTATCATTT pLKO_005 1472 CDS 100% 13.200 9.240 N ENTPD1 n/a
5 TRCN0000219070 GACATTCAGGTTGCAAGTAAT pLKO_005 1011 CDS 100% 13.200 9.240 N ENTPD1 n/a
6 TRCN0000363155 TCCTGTTTGCCATCCATTAAG pLKO_005 2165 3UTR 100% 13.200 9.240 N ENTPD1 n/a
7 TRCN0000230634 TGCTTTCATCCTGGATATAAG pLKO_005 1050 CDS 100% 13.200 9.240 N ENTPD1 n/a
8 TRCN0000230633 GCCTATGGCTGGATTACTATC pLKO_005 732 CDS 100% 10.800 7.560 N ENTPD1 n/a
9 TRCN0000358681 TTGGCTTCTCCTCTATCATAG pLKO_005 268 5UTR 100% 10.800 7.560 N ENTPD1 n/a
10 TRCN0000050288 CCTTCATATTTCTGGAAAGAT pLKO.1 1710 CDS 100% 5.625 3.938 N ENTPD1 n/a
11 TRCN0000050289 GCAGTTTGAAATCCAGGGTAT pLKO.1 1142 CDS 100% 4.050 2.835 N ENTPD1 n/a
12 TRCN0000050292 TCCTCTATCATAGCTGTGATA pLKO.1 276 5UTR 100% 0.495 0.347 N ENTPD1 n/a
13 TRCN0000050290 CGCTGGAGTAAAGGAGAAGTA pLKO.1 1409 CDS 100% 4.950 2.970 N ENTPD1 n/a
14 TRCN0000136945 CCATGATTCAATTACCTCCCA pLKO.1 9301 3UTR 100% 0.660 0.330 Y DISC1 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4863 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 4697 3UTR 100% 4.950 2.475 Y C16orf89 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4863 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540377.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488171 TCATCTCCCGTACCTCATGACTTG pLX_317 20.5% 78.8% 78.8% V5 (not translated due to prior stop codon) 0_1ins324 n/a
2 TRCN0000488654 TTACAATCACTTAGGGAGTACATA pLX_317 23.7% 78.6% 78.6% V5 0_1ins324;1205_1206delTA n/a
Download CSV