Transcript: Human XM_011540763.1

PREDICTED: Homo sapiens NBPF member 4 (NBPF4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NBPF4 (148545)
Length:
3449
CDS:
205..2208

Additional Resources:

NCBI RefSeq record:
XM_011540763.1
NBCI Gene record:
NBPF4 (148545)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540763.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438395 ACGCAAAGGATGGCAGGATGA pLKO_005 2188 CDS 100% 4.050 5.670 N NBPF4 n/a
2 TRCN0000421294 ACCAGTCAGAGGTGCAAGTTT pLKO_005 1769 CDS 100% 5.625 3.938 N NBPF4 n/a
3 TRCN0000416890 GAGCGCAGAGATACCAAATAC pLKO_005 2157 CDS 100% 13.200 7.920 N NBPF4 n/a
4 TRCN0000337216 GAGGAGCTCAGGCAGTATAAA pLKO_005 472 CDS 100% 15.000 7.500 Y NBPF6 n/a
5 TRCN0000337150 TCCCTCCTACCACCCTTATTG pLKO_005 1416 CDS 100% 13.200 6.600 Y NBPF6 n/a
6 TRCN0000337149 ATGAGGATGAAGACGACAAAG pLKO_005 716 CDS 100% 10.800 5.400 Y NBPF6 n/a
7 TRCN0000415417 GTTTAAGTCCAAACACAATAC pLKO_005 2268 3UTR 100% 10.800 5.400 Y NBPF4 n/a
8 TRCN0000167427 GATGAACATCCTAGAAATCAA pLKO.1 246 CDS 100% 5.625 2.813 Y NBPF4 n/a
9 TRCN0000420438 ACAGCAAAGCAAGTTTAAGTC pLKO_005 2256 3UTR 100% 4.950 2.475 Y NBPF4 n/a
10 TRCN0000167347 CACTTGTTCAAATAGTCACAA pLKO.1 837 CDS 100% 4.950 2.475 Y NBPF4 n/a
11 TRCN0000167380 GAAATACAAGTGTGAAGAGTA pLKO.1 375 CDS 100% 4.950 2.475 Y NBPF4 n/a
12 TRCN0000168431 GCAGAGATGAACATCCTAGAA pLKO.1 241 CDS 100% 4.950 2.475 Y NBPF4 n/a
13 TRCN0000337151 TGACCAACCTCAGGGATTTCC pLKO_005 1070 CDS 100% 4.950 2.475 Y NBPF6 n/a
14 TRCN0000350850 GGCTAATCCAGGACACCATGA pLKO_005 1116 CDS 100% 4.050 2.025 Y NBPF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540763.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10609 pDONR223 100% 41.3% 39.7% None (many diffs) n/a
2 ccsbBroad304_10609 pLX_304 0% 41.3% 39.7% V5 (many diffs) n/a
3 TRCN0000491729 GCCACCGCCCTTCATCTCTGACCC pLX_317 44.9% 41.3% 39.7% V5 (many diffs) n/a
Download CSV