Transcript: Human XM_011540845.3

PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 4 (KANK4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KANK4 (163782)
Length:
4399
CDS:
329..3244

Additional Resources:

NCBI RefSeq record:
XM_011540845.3
NBCI Gene record:
KANK4 (163782)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540845.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437483 TCCGAAGAGCCACCCTTATTC pLKO_005 385 CDS 100% 13.200 18.480 N KANK4 n/a
2 TRCN0000099586 CGACCAGCCTTAAATCCATAA pLKO.1 2241 CDS 100% 10.800 15.120 N Kank4 n/a
3 TRCN0000146391 CGTATCCATTACCTCATGGTA pLKO.1 4128 3UTR 100% 3.000 4.200 N KANK4 n/a
4 TRCN0000150212 CCCTAGAAGCAAATATCTGTT pLKO.1 4174 3UTR 100% 4.950 3.465 N KANK4 n/a
5 TRCN0000150287 GAGAGATATAAACCCTCAGAA pLKO.1 2555 CDS 100% 4.950 3.465 N KANK4 n/a
6 TRCN0000148155 GCACATACATTCCTGTTGTAT pLKO.1 3371 3UTR 100% 0.563 0.394 N KANK4 n/a
7 TRCN0000147299 GACAAGGAAGATGAACACAAT pLKO.1 1115 CDS 100% 4.950 2.970 N KANK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540845.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09754 pDONR223 100% 97.2% 97.2% None (many diffs) n/a
2 ccsbBroad304_09754 pLX_304 0% 97.2% 97.2% V5 (many diffs) n/a
3 TRCN0000475731 GTCGCCTAGCGGGCTAAGTGACGC pLX_317 10.5% 97.2% 97.2% V5 (many diffs) n/a
Download CSV