Transcript: Human XM_011541156.1

PREDICTED: Homo sapiens peptidyl arginine deiminase 4 (PADI4), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PADI4 (23569)
Length:
1275
CDS:
29..1189

Additional Resources:

NCBI RefSeq record:
XM_011541156.1
NBCI Gene record:
PADI4 (23569)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541156.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437969 CCAGGTCTGAGATGGACAAAG pLKO_005 639 CDS 100% 10.800 7.560 N PADI4 n/a
2 TRCN0000051681 ACAGAGACAATCTCGAATCTT pLKO.1 492 CDS 100% 5.625 3.938 N PADI4 n/a
3 TRCN0000051678 CTGAAGGAGTTTCCCATCAAA pLKO.1 1154 CDS 100% 5.625 3.938 N PADI4 n/a
4 TRCN0000051679 GATTTCATACTACGGACCCAA pLKO.1 307 CDS 100% 2.640 1.848 N PADI4 n/a
5 TRCN0000413724 TGACTACTCTGGCCATGAAAG pLKO_005 996 CDS 100% 10.800 6.480 N PADI4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541156.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07908 pDONR223 100% 57.8% 57.6% None (many diffs) n/a
2 ccsbBroad304_07908 pLX_304 0% 57.8% 57.6% V5 (many diffs) n/a
3 TRCN0000477124 ACTCTTGCAGACGAATGCTCCTGC pLX_317 20.7% 57.8% 57.6% V5 (many diffs) n/a
Download CSV