Transcript: Human XM_011541264.2

PREDICTED: Homo sapiens G protein subunit alpha transducin 2 (GNAT2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GNAT2 (2780)
Length:
1632
CDS:
305..1369

Additional Resources:

NCBI RefSeq record:
XM_011541264.2
NBCI Gene record:
GNAT2 (2780)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541264.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008802 CCTTGACCTCAATATGCGAAA pLKO.1 1225 CDS 100% 4.050 5.670 N GNAT2 n/a
2 TRCN0000418774 AGGGAGTCACCTGCATCATTT pLKO_005 951 CDS 100% 13.200 9.240 N GNAT2 n/a
3 TRCN0000424090 CAGATACACAGAATGTCAAAT pLKO_005 1284 CDS 100% 13.200 9.240 N GNAT2 n/a
4 TRCN0000008800 CCTCAGGTATAAGTTCTATAA pLKO.1 1381 3UTR 100% 13.200 9.240 N GNAT2 n/a
5 TRCN0000412550 CATTCACCAGGATGGCTATTC pLKO_005 469 CDS 100% 10.800 7.560 N GNAT2 n/a
6 TRCN0000422470 GAAAGTCCATCTCAGCATTTG pLKO_005 1141 CDS 100% 10.800 7.560 N GNAT2 n/a
7 TRCN0000008803 GCATCGATTATGCTGAACCAA pLKO.1 579 CDS 100% 3.000 2.100 N GNAT2 n/a
8 TRCN0000008801 GCATCTTACTACCTGAACCAA pLKO.1 758 CDS 100% 3.000 2.100 N GNAT2 n/a
9 TRCN0000417362 GCTGCAGGAGGATGCTGATAA pLKO_005 370 CDS 100% 13.200 7.920 N GNAT2 n/a
10 TRCN0000097640 CGTCAAACAGATGAAGATCAT pLKO.1 451 CDS 100% 4.950 2.475 Y LOC239863 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541264.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06293 pDONR223 100% 99.9% 100% None 546G>A n/a
2 ccsbBroad304_06293 pLX_304 0% 99.9% 100% V5 546G>A n/a
3 TRCN0000468862 CTTGGGTGATAGCCACCTCACTGC pLX_317 45.1% 99.9% 100% V5 546G>A n/a
4 TRCN0000488518 CCGCGTGCTCGGTTGCTAATGCTA pLX_317 32.2% 99.9% 100% V5 (not translated due to prior stop codon) 546G>A n/a
Download CSV