Transcript: Human XM_011541546.1

PREDICTED: Homo sapiens mitochondrial trans-2-enoyl-CoA reductase (MECR), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MECR (51102)
Length:
1666
CDS:
393..1460

Additional Resources:

NCBI RefSeq record:
XM_011541546.1
NBCI Gene record:
MECR (51102)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541546.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063087 CTGGGCCTAAGAACCATCAAT pLKO.1 783 CDS 100% 5.625 7.875 N MECR n/a
2 TRCN0000063084 CCCTATCAATCCATCTGACAT pLKO.1 404 CDS 100% 4.950 6.930 N MECR n/a
3 TRCN0000063083 CTTCATATCTTCAAAGCAGAT pLKO.1 1427 CDS 100% 4.050 3.240 N MECR n/a
4 TRCN0000245051 ATCAATCCATCTGACATAAAT pLKO_005 408 CDS 100% 15.000 10.500 N MECR n/a
5 TRCN0000245055 GCCAGCCTTAAGGTATCTAAT pLKO_005 1619 3UTR 100% 13.200 9.240 N MECR n/a
6 TRCN0000245052 GGTCCGAGACAGACCTGATAT pLKO_005 806 CDS 100% 13.200 9.240 N MECR n/a
7 TRCN0000245053 GAGCTAAGAAGGCCCGAAATG pLKO_005 885 CDS 100% 10.800 7.560 N MECR n/a
8 TRCN0000063085 CTCAACTGTGTTGGTGGGAAA pLKO.1 1090 CDS 100% 4.050 2.430 N MECR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541546.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08219 pDONR223 100% 68.7% 60.4% None (many diffs) n/a
2 ccsbBroad304_08219 pLX_304 0% 68.7% 60.4% V5 (many diffs) n/a
3 TRCN0000470216 AGTTCCATTTCCCTCCTGACCCGT pLX_317 41.6% 68.7% 60.4% V5 (many diffs) n/a
Download CSV