Transcript: Human XM_011541571.2

PREDICTED: Homo sapiens peptidyl arginine deiminase 3 (PADI3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PADI3 (51702)
Length:
4800
CDS:
1766..3646

Additional Resources:

NCBI RefSeq record:
XM_011541571.2
NBCI Gene record:
PADI3 (51702)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541571.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426926 CACTCTGAAATCATCCATTTG pLKO_005 3931 3UTR 100% 10.800 7.560 N PADI3 n/a
2 TRCN0000425462 TGATTCTGCTTTGGTCCAATT pLKO_005 4037 3UTR 100% 10.800 7.560 N PADI3 n/a
3 TRCN0000051634 CCTCATCAACTACAATAAGTT pLKO.1 3259 CDS 100% 5.625 3.938 N PADI3 n/a
4 TRCN0000051635 CTCTTTGATGACCACAAACTT pLKO.1 2228 CDS 100% 5.625 3.938 N PADI3 n/a
5 TRCN0000051637 CATTGATGACTTCACTCCATA pLKO.1 3541 CDS 100% 4.950 3.465 N PADI3 n/a
6 TRCN0000051633 GCTCTCCAATAAAGACCTCAT pLKO.1 3244 CDS 100% 4.050 2.835 N PADI3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541571.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03367 pDONR223 100% 94.2% 94.2% None 0_1ins114 n/a
2 ccsbBroad304_03367 pLX_304 0% 94.2% 94.2% V5 0_1ins114 n/a
3 TRCN0000480557 TACCGAACACCAAGCTGTTATAAA pLX_317 20.8% 94.2% 94.2% V5 0_1ins114 n/a
4 ccsbBroadEn_08337 pDONR223 100% 94.2% 94.2% None 0_1ins114;1755G>T n/a
5 ccsbBroad304_08337 pLX_304 0% 94.2% 94.2% V5 0_1ins114;1755G>T n/a
6 TRCN0000480351 CTACTATATGGCTACCGTATCGCC pLX_317 16% 94.2% 94.2% V5 0_1ins114;1755G>T n/a
Download CSV