Transcript: Human XM_011541673.2

PREDICTED: Homo sapiens crystallin beta-gamma domain containing 2 (CRYBG2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRYBG2 (55057)
Length:
5469
CDS:
205..5361

Additional Resources:

NCBI RefSeq record:
XM_011541673.2
NBCI Gene record:
CRYBG2 (55057)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541673.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162601 CCCAAGGAATAAGTTTGTTCA pLKO.1 1698 CDS 100% 4.950 3.465 N CRYBG2 n/a
2 TRCN0000166608 CGAGAGGAAGTGGAAGTCAAT pLKO.1 553 CDS 100% 4.950 3.465 N CRYBG2 n/a
3 TRCN0000163037 GCAGAAGGAGATGTTTGAGTT pLKO.1 525 CDS 100% 4.950 3.465 N CRYBG2 n/a
4 TRCN0000164714 CAGCAGAGCTTAAAGACAGCT pLKO.1 1220 CDS 100% 2.640 1.848 N CRYBG2 n/a
5 TRCN0000163642 GAAAGTGCTAAGTAACCTCGT pLKO.1 1080 CDS 100% 2.160 1.512 N CRYBG2 n/a
6 TRCN0000165818 GCAGAGCTTAAAGACAGCTCT pLKO.1 1222 CDS 100% 0.264 0.185 N CRYBG2 n/a
7 TRCN0000164189 CAGGAAGAAGAGACTGTGAAT pLKO.1 586 CDS 100% 4.950 2.970 N CRYBG2 n/a
8 TRCN0000163150 GAAGTGGAAGTCAATGGCTTT pLKO.1 559 CDS 100% 4.050 2.430 N CRYBG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541673.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12147 pDONR223 100% 35.8% 35.8% None 1_3306del n/a
2 ccsbBroad304_12147 pLX_304 0% 35.8% 35.8% V5 1_3306del n/a
3 TRCN0000481400 ACACTTGTGTCTAGTGCGGATGTA pLX_317 21.2% 35.8% 35.8% V5 1_3306del n/a
Download CSV