Transcript: Human XM_011541895.1

PREDICTED: Homo sapiens migration and invasion inhibitory protein (MIIP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MIIP (60672)
Length:
1628
CDS:
225..1391

Additional Resources:

NCBI RefSeq record:
XM_011541895.1
NBCI Gene record:
MIIP (60672)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541895.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262657 ACCAACAAGGAGGAGTGTATC pLKO_005 846 CDS 100% 10.800 7.560 N MIIP n/a
2 TRCN0000262656 CGTGGAGGAAGACCATGAATG pLKO_005 920 CDS 100% 10.800 7.560 N MIIP n/a
3 TRCN0000262653 TCTCCAAGCTGCAGGAGTTTC pLKO_005 820 CDS 100% 10.800 7.560 N MIIP n/a
4 TRCN0000262655 GAGGAGTCTGCAGTTCCTAAG pLKO_005 705 CDS 100% 6.000 4.200 N MIIP n/a
5 TRCN0000262654 GTGTACTGTTACCGTGTCAAC pLKO_005 942 CDS 100% 4.050 2.835 N MIIP n/a
6 TRCN0000180373 GAATGCGTGTACTGTTACCGT pLKO.1 936 CDS 100% 0.750 0.525 N MIIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541895.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08803 pDONR223 100% 99.7% 99.2% None 297A>T;424C>T;499A>G n/a
2 ccsbBroad304_08803 pLX_304 0% 99.7% 99.2% V5 297A>T;424C>T;499A>G n/a
3 TRCN0000473161 AATCACTTTTCTTAATGTCTCAAC pLX_317 8% 99.7% 99.2% V5 297A>T;424C>T;499A>G n/a
Download CSV