Transcript: Human XM_011542435.1

PREDICTED: Homo sapiens F-box protein 44 (FBXO44), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXO44 (93611)
Length:
2316
CDS:
560..1330

Additional Resources:

NCBI RefSeq record:
XM_011542435.1
NBCI Gene record:
FBXO44 (93611)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542435.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430552 CAAGTACCAGCTGTGCGTTCA pLKO_005 1046 CDS 100% 4.050 5.670 N FBXO44 n/a
2 TRCN0000425161 TCTGGAGCCTGGATGTGAATG pLKO_005 837 CDS 100% 10.800 7.560 N FBXO44 n/a
3 TRCN0000420236 CGTCCGCTACATCTGGTTTCA pLKO_005 1187 CDS 100% 4.950 3.465 N FBXO44 n/a
4 TRCN0000073325 CTCCCACACATTCTCCAACTA pLKO.1 1157 CDS 100% 4.950 3.465 N FBXO44 n/a
5 TRCN0000428058 CCTCAAGGCCGAAGGGTATTG pLKO_005 950 CDS 100% 3.600 2.520 N FBXO44 n/a
6 TRCN0000222595 CCAGCAGAAGAGCGATGCCAA pLKO.1 1124 CDS 100% 0.880 0.616 N FBXO44 n/a
7 TRCN0000424492 CGAAAGGTCTTGACCTGAATG pLKO_005 1488 3UTR 100% 10.800 6.480 N FBXO44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542435.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04604 pDONR223 100% 87.5% 87.5% None 363_458del n/a
2 ccsbBroad304_04604 pLX_304 0% 87.5% 87.5% V5 363_458del n/a
3 TRCN0000467327 ATAAGTGAACCAGAGCAAGCGTTC pLX_317 58.2% 87.5% 87.5% V5 363_458del n/a
Download CSV