Transcript: Human XM_011542792.1

PREDICTED: Homo sapiens glutamate metabotropic receptor 5 (GRM5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRM5 (2915)
Length:
8053
CDS:
399..4037

Additional Resources:

NCBI RefSeq record:
XM_011542792.1
NBCI Gene record:
GRM5 (2915)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357424 ATCCCGTCGTCTCCCAAATAT pLKO_005 3969 CDS 100% 15.000 21.000 N GRM5 n/a
2 TRCN0000357423 GAGGGTGAAGAGCATAGTTAA pLKO_005 4373 3UTR 100% 13.200 18.480 N GRM5 n/a
3 TRCN0000009026 CCCGATGTCAAGTGGTTTGAT pLKO.1 1392 CDS 100% 5.625 7.875 N GRM5 n/a
4 TRCN0000009024 GCCATCTATTCGATGGCCTAT pLKO.1 1605 CDS 100% 0.405 0.567 N GRM5 n/a
5 TRCN0000357419 ACGAAGAAACCGACGACAAAT pLKO_005 4201 3UTR 100% 13.200 9.240 N GRM5 n/a
6 TRCN0000367851 TTGTGATCAACGCCATCTATT pLKO_005 1594 CDS 100% 13.200 9.240 N GRM5 n/a
7 TRCN0000009027 CCAAGTATATCGCCTTCACAA pLKO.1 2710 CDS 100% 4.950 3.465 N GRM5 n/a
8 TRCN0000009025 GCCACCCTGTTTGTTACTGTA pLKO.1 2175 CDS 100% 4.950 3.465 N GRM5 n/a
9 TRCN0000009023 CCGTGTTCACACACACACAAT pLKO.1 4084 3UTR 100% 4.950 2.970 N GRM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489279 AAATCCCACGTAACTACTAATCCA pLX_317 10% 97.3% 97.3% V5 (not translated due to prior stop codon) 2629_2724del;3375A>C n/a
2 TRCN0000489226 CCATCTCCACAAAATCGCTAAGCA pLX_317 9.8% 97.3% 97.2% V5 2629_2724del;3375A>C;3636_3637insG n/a
Download CSV