Transcript: Human XM_011543493.3

PREDICTED: Homo sapiens phosphoinositide-3-kinase regulatory subunit 1 (PIK3R1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIK3R1 (5295)
Length:
6629
CDS:
562..2409

Additional Resources:

NCBI RefSeq record:
XM_011543493.3
NBCI Gene record:
PIK3R1 (5295)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543493.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039903 GCGCTATGCAATTCTTAATTT pLKO.1 3210 3UTR 100% 15.000 21.000 N PIK3R1 n/a
2 TRCN0000416842 AGTGGTGGACGGCGAAGTAAA pLKO_005 2217 CDS 100% 13.200 18.480 N PIK3R1 n/a
3 TRCN0000039907 CCGTTTACAGTGAAATGATTT pLKO.1 836 CDS 100% 13.200 18.480 N PIK3R1 n/a
4 TRCN0000413602 TTCATCGAGATGGGAAATATG pLKO_005 1385 CDS 100% 13.200 18.480 N PIK3R1 n/a
5 TRCN0000033288 GCGGTACAGCAAAGAATACAT pLKO.1 1740 CDS 100% 5.625 7.875 N PIK3R1 n/a
6 TRCN0000200002 CCGAGCCCTATAACTTGTACA pLKO.1 2279 CDS 100% 4.950 6.930 N PIK3R1 n/a
7 TRCN0000199643 GCCCTCAAACTTGACTCTACT pLKO.1 4646 3UTR 100% 4.950 6.930 N PIK3R1 n/a
8 TRCN0000039563 TACTGTAGCCAACAACGGTAT pLKO.1 1179 CDS 100% 4.050 5.670 N PIK3R1 n/a
9 TRCN0000199461 GCAGAGGCACTCCTGATATAT pLKO.1 5208 3UTR 100% 15.000 12.000 N PIK3R1 n/a
10 TRCN0000432098 GGCAGCTGAGTATCGAGAAAT pLKO_005 1890 CDS 100% 13.200 10.560 N PIK3R1 n/a
11 TRCN0000196285 GCATGGTGATTATACTCTTAC pLKO.1 1326 CDS 100% 10.800 8.640 N PIK3R1 n/a
12 TRCN0000417698 ACATCGCACTGTGGATTATTT pLKO_005 2888 3UTR 100% 15.000 10.500 N PIK3R1 n/a
13 TRCN0000413458 AGTCGAGAATATGATAGATTA pLKO_005 1612 CDS 100% 13.200 9.240 N PIK3R1 n/a
14 TRCN0000430557 TAACCATGGTGCTTGTTAATG pLKO_005 2734 3UTR 100% 13.200 9.240 N PIK3R1 n/a
15 TRCN0000430938 TACTTTATCCAGTATCCAAAT pLKO_005 1505 CDS 100% 10.800 7.560 N PIK3R1 n/a
16 TRCN0000039904 CGAGGGAAGAAGTGAATGAAA pLKO.1 1250 CDS 100% 5.625 3.938 N PIK3R1 n/a
17 TRCN0000039906 CGGTACAGCAAAGAATACATA pLKO.1 1741 CDS 100% 5.625 3.938 N PIK3R1 n/a
18 TRCN0000033285 CCCATCATGATGAGAAGACAT pLKO.1 2084 CDS 100% 4.950 3.465 N PIK3R1 n/a
19 TRCN0000033287 CCTCAATGTCACACTAGCCTA pLKO.1 2361 CDS 100% 2.640 1.848 N PIK3R1 n/a
20 TRCN0000033284 CCTTCAGTTCTGTGGTTGAAT pLKO.1 1424 CDS 100% 5.625 3.375 N PIK3R1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543493.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06728 pDONR223 100% 71.4% 66.4% None (many diffs) n/a
2 ccsbBroad304_06728 pLX_304 47% 71.4% 66.4% V5 (many diffs) n/a
3 TRCN0000466732 GGCTCTGGTGCGGACAGCAGAAGC pLX_317 34.3% 71.4% 66.4% V5 (many diffs) n/a
4 ccsbBroadEn_14763 pDONR223 0% 71.4% 66.4% None (many diffs) n/a
5 ccsbBroad304_14763 pLX_304 49.6% 71.4% 66.4% V5 (many diffs) n/a
6 TRCN0000470397 TTCACCGGAGCCTGAGATAGGCTA pLX_317 32.4% 71.4% 66.4% V5 (many diffs) n/a
Download CSV