Transcript: Human XM_011543502.1

PREDICTED: Homo sapiens zinc finger CCHC-type containing 10 (ZCCHC10), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZCCHC10 (54819)
Length:
2231
CDS:
67..633

Additional Resources:

NCBI RefSeq record:
XM_011543502.1
NBCI Gene record:
ZCCHC10 (54819)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134644 GCAGTGGATTTCTAATGCTTT pLKO.1 1003 3UTR 100% 4.950 6.930 N ZCCHC10 n/a
2 TRCN0000319101 GCAGTGGATTTCTAATGCTTT pLKO_005 1003 3UTR 100% 4.950 6.930 N ZCCHC10 n/a
3 TRCN0000133700 GCAACATGTAAGATGTCAGAA pLKO.1 216 CDS 100% 4.950 3.465 N ZCCHC10 n/a
4 TRCN0000351620 GCAACATGTAAGATGTCAGAA pLKO_005 216 CDS 100% 4.950 3.465 N ZCCHC10 n/a
5 TRCN0000198875 GCTTGGAATTTGGACATTGGA pLKO.1 239 CDS 100% 3.000 2.100 N Zcchc10 n/a
6 TRCN0000134841 CAGAGAGTGAAGAAACATCTA pLKO.1 428 CDS 100% 4.950 2.970 N ZCCHC10 n/a
7 TRCN0000319027 CAGAGAGTGAAGAAACATCTA pLKO_005 428 CDS 100% 4.950 2.970 N ZCCHC10 n/a
8 TRCN0000197503 CATTGGACTTATGAATGCAAA pLKO.1 253 CDS 100% 4.950 3.465 N Zcchc10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12089 pDONR223 100% 88.1% 88.1% None 106_135del;295_296ins42 n/a
2 ccsbBroad304_12089 pLX_304 0% 88.1% 88.1% V5 106_135del;295_296ins42 n/a
3 TRCN0000478645 GCGCTTACTCCTGTGCGCTGACCT pLX_317 64.2% 88.1% 88.1% V5 106_135del;295_296ins42 n/a
4 ccsbBroadEn_08413 pDONR223 100% 77.2% 77.2% None 42_137del;295_296ins42 n/a
5 ccsbBroad304_08413 pLX_304 0% 77.2% 77.2% V5 42_137del;295_296ins42 n/a
6 TRCN0000491505 TGAATTGTCGCCCCCAGATACACC pLX_317 74.3% 77.2% 77.2% V5 42_137del;295_296ins42 n/a
Download CSV