Transcript: Human XM_011543509.2

PREDICTED: Homo sapiens DEP domain containing 1B (DEPDC1B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DEPDC1B (55789)
Length:
2497
CDS:
112..1656

Additional Resources:

NCBI RefSeq record:
XM_011543509.2
NBCI Gene record:
DEPDC1B (55789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543509.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061872 GCTGCTAGATTGGTAACGTTT pLKO.1 1198 CDS 100% 4.950 6.930 N DEPDC1B n/a
2 TRCN0000061869 GCAGCCTATGTACTTGGGATT pLKO.1 846 CDS 100% 4.050 5.670 N DEPDC1B n/a
3 TRCN0000194491 GCAGCCTATGTACTTGGGATT pLKO.1 846 CDS 100% 4.050 5.670 N Depdc1b n/a
4 TRCN0000430173 TTGAAGACAATCGTCACTTAT pLKO_005 356 CDS 100% 13.200 10.560 N DEPDC1B n/a
5 TRCN0000061868 GCTGCTAATGTGGGCACTAAA pLKO.1 1590 CDS 100% 13.200 9.240 N DEPDC1B n/a
6 TRCN0000061870 CGCTGTCGTTTCAAGAGCTAT pLKO.1 166 CDS 100% 4.950 3.465 N DEPDC1B n/a
7 TRCN0000061871 CGTCAAATTAGTCCAGAGGAA pLKO.1 1363 CDS 100% 2.640 1.848 N DEPDC1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543509.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08587 pDONR223 100% 96.9% 96.5% None 1_1delAins46;950G>T;1138G>C n/a
2 ccsbBroad304_08587 pLX_304 0% 96.9% 96.5% V5 1_1delAins46;950G>T;1138G>C n/a
3 ccsbBroadEn_14207 pDONR223 100% 36.3% 36.1% None 1_981del;1526C>A n/a
4 ccsbBroad304_14207 pLX_304 0% 36.3% 36.1% V5 1_981del;1526C>A n/a
Download CSV