Transcript: Human XM_011543630.2

PREDICTED: Homo sapiens ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 (ST8SIA4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ST8SIA4 (7903)
Length:
5753
CDS:
319..1104

Additional Resources:

NCBI RefSeq record:
XM_011543630.2
NBCI Gene record:
ST8SIA4 (7903)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543630.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431489 AGCGGTCAAATATCATTATTA pLKO_005 954 CDS 100% 15.000 21.000 N ST8SIA4 n/a
2 TRCN0000035210 CCTCACAGAATGCCATTAGAA pLKO.1 1012 CDS 100% 5.625 7.875 N ST8SIA4 n/a
3 TRCN0000430931 AGTGCACTCATCATTAGTTAA pLKO_005 1375 3UTR 100% 13.200 9.240 N ST8SIA4 n/a
4 TRCN0000035213 CCACAAGATTCTGTGATGAAA pLKO.1 887 CDS 100% 5.625 3.938 N ST8SIA4 n/a
5 TRCN0000035209 CCAATGAAGAATCGCAGGTTT pLKO.1 715 CDS 100% 4.950 3.465 N ST8SIA4 n/a
6 TRCN0000035211 CGGACACTAAACATTTCTCAT pLKO.1 664 CDS 100% 4.950 3.465 N ST8SIA4 n/a
7 TRCN0000035212 GCTGACCAACAAAGTTCCTAT pLKO.1 828 CDS 100% 4.950 3.465 N ST8SIA4 n/a
8 TRCN0000093937 CCTGAAGTTTCACCAATGAAA pLKO.1 703 CDS 100% 0.563 0.394 N St8sia4 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2013 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2013 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543630.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07186 pDONR223 100% 64.1% 63.6% None 20G>A;504_783delinsG n/a
2 ccsbBroad304_07186 pLX_304 0% 64.1% 63.6% V5 20G>A;504_783delinsG n/a
3 TRCN0000470116 TCTGCCCACCCAGCGGGCCTGAGG pLX_317 3.8% 64.1% 63.6% V5 20G>A;504_783delinsG n/a
Download CSV