Transcript: Human XM_011544158.2

PREDICTED: Homo sapiens olfactory receptor family 2 subfamily L member 2 (OR2L2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OR2L2 (26246)
Length:
1291
CDS:
227..1165

Additional Resources:

NCBI RefSeq record:
XM_011544158.2
NBCI Gene record:
OR2L2 (26246)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544158.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000583969 GTCAAAGCGCTAGGTTCATAT pLKO_005 1185 3UTR 100% 13.200 18.480 N OR2L2 n/a
2 TRCN0000583873 TACGTTCTGTGTTAGAGTCAA pLKO_005 1169 3UTR 100% 4.950 6.930 N OR2L2 n/a
3 TRCN0000583913 CTCCCTCATTGACCTAAATTA pLKO_005 421 CDS 100% 15.000 7.500 Y n/a
4 TRCN0000583929 TCTCCCTCATTGACCTAAATT pLKO_005 420 CDS 100% 15.000 7.500 Y n/a
5 TRCN0000359835 CTCTCCCTCATTGACCTAAAT pLKO_005 419 CDS 100% 13.200 6.600 Y OR2L3 n/a
6 TRCN0000202646 CTAAATTACATCTCCACCATT pLKO.1 434 CDS 100% 4.950 2.475 Y OR2L8 n/a
7 TRCN0000061294 CCTAAATTACATCTCCACCAT pLKO.1 433 CDS 100% 2.640 1.320 Y OR2L3 n/a
8 TRCN0000186136 CCTAAATTACATCTCCACCAT pLKO.1 433 CDS 100% 2.640 1.320 Y OR2L8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544158.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02938 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02938 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491631 AGATCAACGCGCCCATACGCACAT pLX_317 19.9% 100% 100% V5 n/a
Download CSV