Transcript: Human XM_011544184.2

PREDICTED: Homo sapiens potassium two pore domain channel subfamily K member 1 (KCNK1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNK1 (3775)
Length:
2315
CDS:
539..1345

Additional Resources:

NCBI RefSeq record:
XM_011544184.2
NBCI Gene record:
KCNK1 (3775)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544184.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296138 AGCGTAGGATTTGTTGCATTA pLKO_005 1345 CDS 100% 10.800 15.120 N KCNK1 n/a
2 TRCN0000296085 TCAGAGAGCTCTATAAGATTG pLKO_005 1056 CDS 100% 10.800 8.640 N KCNK1 n/a
3 TRCN0000310197 GCATCATCTACTCCGTCATTG pLKO_005 735 CDS 100% 10.800 7.560 N KCNK1 n/a
4 TRCN0000044726 ACTTGGCCTTATTGCCATGTT pLKO.1 1096 CDS 100% 4.950 3.465 N KCNK1 n/a
5 TRCN0000044723 CGACCTTACATAGGAGGAGAA pLKO.1 1596 3UTR 100% 4.050 2.835 N KCNK1 n/a
6 TRCN0000288909 CGACCTTACATAGGAGGAGAA pLKO_005 1596 3UTR 100% 4.050 2.835 N KCNK1 n/a
7 TRCN0000044724 CACATCATAGAGCATGACCAA pLKO.1 1208 CDS 100% 2.640 1.848 N KCNK1 n/a
8 TRCN0000044725 GATGACTGGAACTTCCTGGAA pLKO.1 956 CDS 100% 2.640 1.848 N KCNK1 n/a
9 TRCN0000044727 GCCCTTGTCAGATGGAGGTAA pLKO.1 706 CDS 100% 4.950 2.970 N KCNK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544184.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06483 pDONR223 100% 71.8% 64.5% None (many diffs) n/a
2 ccsbBroad304_06483 pLX_304 0% 71.8% 64.5% V5 (many diffs) n/a
3 TRCN0000473228 ATCAGGACTCTTCCTTCGAACTCC pLX_317 37% 71.8% 64.5% V5 (many diffs) n/a
Download CSV