Transcript: Human XM_011544188.3

PREDICTED: Homo sapiens galectin 8 (LGALS8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LGALS8 (3964)
Length:
3857
CDS:
181..1170

Additional Resources:

NCBI RefSeq record:
XM_011544188.3
NBCI Gene record:
LGALS8 (3964)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544188.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057353 CGCCTGAATATTAAAGCATTT pLKO.1 1003 CDS 100% 10.800 15.120 N LGALS8 n/a
2 TRCN0000419213 TATCATCTATAACCCGGTAAT pLKO_005 210 CDS 100% 10.800 8.640 N LGALS8 n/a
3 TRCN0000057356 GAGCAAAGATTCGACTGTCAA pLKO.1 786 CDS 100% 4.950 3.960 N LGALS8 n/a
4 TRCN0000416178 TATTACCTCTTTCCCATTTAG pLKO_005 1071 CDS 100% 13.200 9.240 N LGALS8 n/a
5 TRCN0000057354 CCTGGAACTTTGATTGTGATA pLKO.1 265 CDS 100% 4.950 3.465 N LGALS8 n/a
6 TRCN0000057355 GCAAAGTGAATATTCACTCAA pLKO.1 605 CDS 100% 0.495 0.347 N LGALS8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544188.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10438 pDONR223 100% 88.8% 86% None (many diffs) n/a
2 ccsbBroad304_10438 pLX_304 0% 88.8% 86% V5 (many diffs) n/a
3 TRCN0000472443 GGTGAGATCTCTGTGTCTTCTTAT pLX_317 46.4% 88.8% 86% V5 (many diffs) n/a
4 ccsbBroadEn_10205 pDONR223 100% 77.7% 75.4% None (many diffs) n/a
5 ccsbBroad304_10205 pLX_304 0% 77.7% 75.4% V5 (many diffs) n/a
6 TRCN0000468715 CCGGTCATATTCAGCACCATGCCT pLX_317 37.3% 77.7% 75.4% V5 (many diffs) n/a
Download CSV