Transcript: Human XM_011544332.3

PREDICTED: Homo sapiens transmembrane protein 63A (TMEM63A), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM63A (9725)
Length:
4057
CDS:
672..2654

Additional Resources:

NCBI RefSeq record:
XM_011544332.3
NBCI Gene record:
TMEM63A (9725)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544332.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126435 CCTCTATACCTTCCGCATGAT pLKO.1 1967 CDS 100% 4.950 6.930 N Tmem63a n/a
2 TRCN0000316315 CCTCTATACCTTCCGCATGAT pLKO_005 1967 CDS 100% 4.950 6.930 N Tmem63a n/a
3 TRCN0000152407 CATCTCTTACTACACACGGAT pLKO.1 1190 CDS 100% 2.640 3.696 N TMEM63A n/a
4 TRCN0000152742 GACCACTCATAATATGCCCAT pLKO.1 3262 3UTR 100% 2.160 3.024 N TMEM63A n/a
5 TRCN0000154883 CCATCTCTTACTACACACGGA pLKO.1 1189 CDS 100% 0.660 0.924 N TMEM63A n/a
6 TRCN0000153743 CGAGTCCAGATTTCAGAGATT pLKO.1 549 5UTR 100% 4.950 3.960 N TMEM63A n/a
7 TRCN0000154906 GCTGTGTGTCTTCACTGTCAT pLKO.1 2072 CDS 100% 4.950 3.465 N TMEM63A n/a
8 TRCN0000152335 CCTGTTCTTAATCTTGGTGTT pLKO.1 465 5UTR 100% 4.050 2.835 N TMEM63A n/a
9 TRCN0000153898 CCTGACCTATTACACAAACCT pLKO.1 1076 CDS 100% 3.000 2.100 N TMEM63A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544332.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02232 pDONR223 100% 81.7% 77.8% None 0_1ins389;125_126ins52 n/a
2 ccsbBroad304_02232 pLX_304 0% 81.7% 77.8% V5 0_1ins389;125_126ins52 n/a
3 TRCN0000472089 CCCTAGCCAGCCTCGAGAGCTGGG pLX_317 15.3% 81.7% 77.8% V5 0_1ins389;125_126ins52 n/a
Download CSV