Transcript: Human XM_011544452.2

PREDICTED: Homo sapiens fibroblast growth factor receptor 1 (FGFR1), transcript variant X31, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FGFR1 (2260)
Length:
2495
CDS:
239..1723

Additional Resources:

NCBI RefSeq record:
XM_011544452.2
NBCI Gene record:
FGFR1 (2260)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544452.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121311 GAATGAGTACGGCAGCATCAA pLKO.1 1030 CDS 100% 4.950 6.930 N FGFR1 n/a
2 TRCN0000121103 CCGGCCTCTATGCTTGCGTAA pLKO.1 624 CDS 100% 1.350 1.890 N FGFR1 n/a
3 TRCN0000121185 CCACAGAATTGGAGGCTACAA pLKO.1 931 CDS 100% 4.950 3.960 N FGFR1 n/a
4 TRCN0000312572 CCACAGAATTGGAGGCTACAA pLKO_005 931 CDS 100% 4.950 3.960 N FGFR1 n/a
5 TRCN0000312574 TGCCACCTGGAGCATCATAAT pLKO_005 961 CDS 100% 13.200 9.240 N FGFR1 n/a
6 TRCN0000427411 CCACCTACTTCTCCGTCAATG pLKO_005 669 CDS 100% 10.800 7.560 N Fgfr1 n/a
7 TRCN0000121105 GCCAAGACAGTGAAGTTCAAA pLKO.1 842 CDS 100% 5.625 3.938 N FGFR1 n/a
8 TRCN0000000420 CGTCAATGTTTCAGATGCTCT pLKO.1 682 CDS 100% 2.640 1.848 N FGFR1 n/a
9 TRCN0000000419 CAGAGGAGAAAGAAACAGATA pLKO.1 744 CDS 100% 4.950 2.970 N FGFR1 n/a
10 TRCN0000023295 CCTGGAGCATCATAATGGATT pLKO.1 966 CDS 100% 4.950 2.970 N Fgfr1 n/a
11 TRCN0000321966 CCTGGAGCATCATAATGGATT pLKO_005 966 CDS 100% 4.950 2.970 N Fgfr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544452.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14638 pDONR223 0% 47.1% 37.5% None (many diffs) n/a
2 ccsbBroad304_14638 pLX_304 0% 47.1% 37.5% V5 (many diffs) n/a
3 TRCN0000488713 AAGAGGCTTCCCATAGTAATAAAT pLX_317 14.1% 47.1% 37.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV