Transcript: Human XM_011544534.2

PREDICTED: Homo sapiens pericentriolar material 1 (PCM1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCM1 (5108)
Length:
9231
CDS:
496..6945

Additional Resources:

NCBI RefSeq record:
XM_011544534.2
NBCI Gene record:
PCM1 (5108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322932 AGCTTTGCGAGATACTATTTA pLKO_005 5019 CDS 100% 15.000 21.000 N PCM1 n/a
2 TRCN0000322935 TTGTTCAAATTCGCGATTATA pLKO_005 1121 CDS 100% 15.000 21.000 N PCM1 n/a
3 TRCN0000118948 GCGGATAAACTTCAGTGATTT pLKO.1 810 CDS 100% 13.200 18.480 N PCM1 n/a
4 TRCN0000322931 AGATGCACCTGCAGGATTATT pLKO_005 5503 CDS 100% 15.000 10.500 N PCM1 n/a
5 TRCN0000322934 TGATGTTTGGTAACGAATTTA pLKO_005 7197 3UTR 100% 15.000 10.500 N PCM1 n/a
6 TRCN0000322863 CAGTAGGACACCATGGTTATA pLKO_005 4422 CDS 100% 13.200 9.240 N PCM1 n/a
7 TRCN0000118949 CGGATAAACTTCAGTGATTTA pLKO.1 811 CDS 100% 13.200 9.240 N PCM1 n/a
8 TRCN0000118950 CCATTTATCAAGACTGGATTT pLKO.1 4468 CDS 100% 10.800 7.560 N PCM1 n/a
9 TRCN0000118951 GCAGCTACTAAACACAGACTA pLKO.1 5112 CDS 100% 4.950 3.465 N PCM1 n/a
10 TRCN0000118947 GCTCATCTAACTCTGTCCTTA pLKO.1 6959 3UTR 100% 4.950 3.465 N PCM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11020 pDONR223 100% 24.6% 24.6% None 476_477delACinsGT;900_1088del;1780_6447del n/a
2 ccsbBroad304_11020 pLX_304 0% 24.6% 24.6% V5 476_477delACinsGT;900_1088del;1780_6447del n/a
3 TRCN0000467367 ACTCGGGGTTTTGCCCGAAGCCTT pLX_317 19.5% 24.6% 24.6% V5 476_477delACinsGT;900_1088del;1780_6447del n/a
Download CSV