Transcript: Human XM_011544772.1

PREDICTED: Homo sapiens spindlin interactor and repressor of chromatin binding (SPINDOC), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPINDOC (144097)
Length:
2000
CDS:
314..1342

Additional Resources:

NCBI RefSeq record:
XM_011544772.1
NBCI Gene record:
SPINDOC (144097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263946 TTACACAAGAGTGGTCATAAG pLKO_005 1763 3UTR 100% 10.800 15.120 N SPINDOC n/a
2 TRCN0000282872 GCCCACAGTTCTGTCAGAATC pLKO_005 1355 3UTR 100% 10.800 7.560 N SPINDOC n/a
3 TRCN0000263948 CCCTTCTGAGAAGAGCAATAT pLKO_005 676 CDS 100% 13.200 7.920 N SPINDOC n/a
4 TRCN0000172889 GCCCTTCTGAGAAGAGCAATA pLKO.1 675 CDS 100% 10.800 6.480 N SPINDOC n/a
5 TRCN0000263947 TCTCCTTGACTCTGAGGATAA pLKO_005 844 CDS 100% 10.800 6.480 N SPINDOC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04966 pDONR223 100% 89.6% 84.5% None 574C>A;927_928ins38;1026_1027ins79 n/a
2 ccsbBroad304_04966 pLX_304 0% 89.6% 84.5% V5 574C>A;927_928ins38;1026_1027ins79 n/a
3 TRCN0000481391 CAGCCTCTCCAGACCCCCTGCCTT pLX_317 39.2% 89.6% 84.5% V5 574C>A;927_928ins38;1026_1027ins79 n/a
Download CSV