Transcript: Human XM_011544840.2

PREDICTED: Homo sapiens coiled-coil domain containing 83 (CCDC83), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC83 (220047)
Length:
2012
CDS:
171..1505

Additional Resources:

NCBI RefSeq record:
XM_011544840.2
NBCI Gene record:
CCDC83 (220047)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134904 CATGAAAGAAATAGCCGCTTA pLKO.1 342 CDS 100% 4.050 3.240 N CCDC83 n/a
2 TRCN0000134771 GCCTTTGGAATCATGTCTAAT pLKO.1 1019 CDS 100% 13.200 9.240 N CCDC83 n/a
3 TRCN0000135263 CTCATCAGATGAGAGCACTAT pLKO.1 1190 CDS 100% 4.950 3.465 N CCDC83 n/a
4 TRCN0000136689 GAAGCATGACAGTGGGTTCAA pLKO.1 1733 3UTR 100% 4.950 3.465 N CCDC83 n/a
5 TRCN0000136057 GCAATTCACAGGAAGGAAGTT pLKO.1 846 CDS 100% 4.950 3.465 N CCDC83 n/a
6 TRCN0000137352 GCTCATTGACAAGGGCAGTTA pLKO.1 785 CDS 100% 4.950 3.465 N CCDC83 n/a
7 TRCN0000135500 GCTGCAAAGGAAACACAACTT pLKO.1 1514 3UTR 100% 4.950 3.465 N CCDC83 n/a
8 TRCN0000133679 GTAACAAGAGAGGATGTTGAA pLKO.1 438 CDS 100% 4.950 3.465 N CCDC83 n/a
9 TRCN0000134705 GTTGTAACAAGAGAGGATGTT pLKO.1 435 CDS 100% 4.950 3.465 N CCDC83 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13410 pDONR223 100% 92.9% 92.7% None 680T>C;794_886del n/a
2 ccsbBroad304_13410 pLX_304 0% 92.9% 92.7% V5 680T>C;794_886del n/a
3 TRCN0000472734 TCGGTCACTAGTTACTCTTGAAGT pLX_317 44% 92.9% 92.7% V5 680T>C;794_886del n/a
Download CSV