Transcript: Human XM_011545196.2

PREDICTED: Homo sapiens RAB3A interacting protein like 1 (RAB3IL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB3IL1 (5866)
Length:
1827
CDS:
73..1536

Additional Resources:

NCBI RefSeq record:
XM_011545196.2
NBCI Gene record:
RAB3IL1 (5866)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545196.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140552 GCCATTACTACATCTCGCCAT pLKO.1 1178 CDS 100% 2.160 3.024 N RAB3IL1 n/a
2 TRCN0000141657 CATTACTACATCTCGCCATCT pLKO.1 1180 CDS 100% 4.050 3.240 N RAB3IL1 n/a
3 TRCN0000140658 CCTGTTTGAGGAAGCTCACAA pLKO.1 564 CDS 100% 4.950 3.465 N RAB3IL1 n/a
4 TRCN0000140631 GAGGAAGCTCACAAGATGGTT pLKO.1 571 CDS 100% 3.000 2.100 N RAB3IL1 n/a
5 TRCN0000139880 GCTAAAGGACGAGGAATGTGA pLKO.1 486 CDS 100% 3.000 2.100 N RAB3IL1 n/a
6 TRCN0000140933 CTGAAGCTAAAGGACGAGGAA pLKO.1 481 CDS 100% 2.640 1.848 N RAB3IL1 n/a
7 TRCN0000141192 CACAATCCTGTTTGCAGAGTT pLKO.1 876 CDS 100% 4.950 2.970 N RAB3IL1 n/a
8 TRCN0000139844 CTTCACCTACATCCGCTACAT pLKO.1 1233 CDS 100% 4.950 2.970 N RAB3IL1 n/a
9 TRCN0000142496 GTGCAACTTCTTCACCTACAT pLKO.1 1224 CDS 100% 4.950 2.970 N RAB3IL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545196.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01359 pDONR223 100% 75.9% 74.2% None (many diffs) n/a
2 ccsbBroad304_01359 pLX_304 0% 75.9% 74.2% V5 (many diffs) n/a
3 TRCN0000475494 CCCCTAGTCAGCCACCACAGAATC pLX_317 43.6% 75.9% 50.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15558 pDONR223 0% 70.9% 69.5% None (many diffs) n/a
5 ccsbBroad304_15558 pLX_304 0% 70.9% 69.5% V5 (many diffs) n/a
Download CSV