Transcript: Human XM_011545225.1

PREDICTED: Homo sapiens calpain 5 (CAPN5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAPN5 (726)
Length:
4514
CDS:
187..2229

Additional Resources:

NCBI RefSeq record:
XM_011545225.1
NBCI Gene record:
CAPN5 (726)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545225.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423492 CCACTGCTAAGGGACTCTATC pLKO_005 2476 3UTR 100% 10.800 15.120 N CAPN5 n/a
2 TRCN0000417672 TAACTCTTATGTGATCATCAA pLKO_005 1914 CDS 100% 4.950 3.960 N CAPN5 n/a
3 TRCN0000005236 CGAGTGCTGAAGGATGAATTT pLKO.1 2059 CDS 100% 13.200 9.240 N CAPN5 n/a
4 TRCN0000431274 CCATTCTCGTGGAGGAGTTTC pLKO_005 2414 3UTR 100% 10.800 7.560 N CAPN5 n/a
5 TRCN0000005235 CAGCTCTTTGAGCGCATGTTA pLKO.1 943 CDS 100% 5.625 3.938 N CAPN5 n/a
6 TRCN0000005234 GCCAAGAAGATGTCACTTGTT pLKO.1 2540 3UTR 100% 4.950 3.465 N CAPN5 n/a
7 TRCN0000005238 GTACAATGTGAAAGGCATCTT pLKO.1 1989 CDS 100% 4.950 3.465 N CAPN5 n/a
8 TRCN0000005237 CACAGTCAACAACCAGCTCAT pLKO.1 729 CDS 100% 4.050 2.835 N CAPN5 n/a
9 TRCN0000030698 GCCAGCTCCATCTACATCAAT pLKO.1 1645 CDS 100% 5.625 3.938 N Capn5 n/a
10 TRCN0000308772 GCCAGCTCCATCTACATCAAT pLKO_005 1645 CDS 100% 5.625 3.938 N Capn5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545225.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00187 pDONR223 100% 94.1% 94.1% None 1_120del n/a
2 ccsbBroad304_00187 pLX_304 0% 94.1% 94.1% V5 1_120del n/a
3 TRCN0000471227 CAGAGCTCGTCCAAAATCATGAAC pLX_317 24.6% 94.1% 94.1% V5 1_120del n/a
Download CSV