Transcript: Human XM_011545332.1

PREDICTED: Homo sapiens autophagy related 16 like 2 (ATG16L2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATG16L2 (89849)
Length:
2030
CDS:
40..1785

Additional Resources:

NCBI RefSeq record:
XM_011545332.1
NBCI Gene record:
ATG16L2 (89849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134177 CAATGTCCTTTCCTACTGTAA pLKO.1 1305 CDS 100% 4.950 3.465 N ATG16L2 n/a
2 TRCN0000137367 GCTTCAAGTGTGGTTCTGACT pLKO.1 1556 CDS 100% 2.640 1.848 N ATG16L2 n/a
3 TRCN0000136912 CAATGACCAGAAGATCCGGTT pLKO.1 1365 CDS 100% 2.160 1.512 N ATG16L2 n/a
4 TRCN0000136901 CCAGGACCATCAATGTCCTTT pLKO.1 1295 CDS 100% 0.495 0.347 N ATG16L2 n/a
5 TRCN0000134030 CCTATAACCATCTCTTAGAGA pLKO.1 155 CDS 100% 3.000 1.800 N ATG16L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09276 pDONR223 100% 93.8% 93.8% None 710_711ins114 n/a
2 ccsbBroad304_09276 pLX_304 0% 93.8% 93.8% V5 710_711ins114 n/a
3 TRCN0000477269 GCTAGGGCAGTCTCGTTTCAAATC pLX_317 11.5% 93.8% 93.8% V5 710_711ins114 n/a
Download CSV