Transcript: Human XM_011545333.1

PREDICTED: Homo sapiens autophagy related 16 like 2 (ATG16L2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATG16L2 (89849)
Length:
2593
CDS:
807..2348

Additional Resources:

NCBI RefSeq record:
XM_011545333.1
NBCI Gene record:
ATG16L2 (89849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545333.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134177 CAATGTCCTTTCCTACTGTAA pLKO.1 1868 CDS 100% 4.950 3.465 N ATG16L2 n/a
2 TRCN0000137367 GCTTCAAGTGTGGTTCTGACT pLKO.1 2119 CDS 100% 2.640 1.848 N ATG16L2 n/a
3 TRCN0000136912 CAATGACCAGAAGATCCGGTT pLKO.1 1928 CDS 100% 2.160 1.512 N ATG16L2 n/a
4 TRCN0000136901 CCAGGACCATCAATGTCCTTT pLKO.1 1858 CDS 100% 0.495 0.347 N ATG16L2 n/a
5 TRCN0000134030 CCTATAACCATCTCTTAGAGA pLKO.1 135 5UTR 100% 3.000 1.800 N ATG16L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545333.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09276 pDONR223 100% 82.8% 82.7% None 0_1ins318;415G>T n/a
2 ccsbBroad304_09276 pLX_304 0% 82.8% 82.7% V5 0_1ins318;415G>T n/a
3 TRCN0000477269 GCTAGGGCAGTCTCGTTTCAAATC pLX_317 11.5% 82.8% 82.7% V5 0_1ins318;415G>T n/a
Download CSV