Transcript: Human XM_011545876.2

PREDICTED: Homo sapiens Rho GTPase activating protein 17 (ARHGAP17), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP17 (55114)
Length:
3642
CDS:
111..2729

Additional Resources:

NCBI RefSeq record:
XM_011545876.2
NBCI Gene record:
ARHGAP17 (55114)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545876.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047452 CCCAAGCAGATTACCATAGAA pLKO.1 763 CDS 100% 5.625 7.875 N ARHGAP17 n/a
2 TRCN0000286245 CCCAAGCAGATTACCATAGAA pLKO_005 763 CDS 100% 5.625 7.875 N ARHGAP17 n/a
3 TRCN0000047448 CCCGAGTTCTAATCACTCATT pLKO.1 1583 CDS 100% 4.950 3.960 N ARHGAP17 n/a
4 TRCN0000286247 CCCGAGTTCTAATCACTCATT pLKO_005 1583 CDS 100% 4.950 3.960 N ARHGAP17 n/a
5 TRCN0000293697 AGTGCGTTAACTATCTATTTA pLKO_005 3266 3UTR 100% 15.000 10.500 N ARHGAP17 n/a
6 TRCN0000047449 GCAGTGATTGAACCCATCATT pLKO.1 1491 CDS 100% 5.625 3.938 N ARHGAP17 n/a
7 TRCN0000047450 GCACGAAGTCTTTGTTGAGAA pLKO.1 440 CDS 100% 4.950 3.465 N ARHGAP17 n/a
8 TRCN0000286320 GCACGAAGTCTTTGTTGAGAA pLKO_005 440 CDS 100% 4.950 3.465 N ARHGAP17 n/a
9 TRCN0000047451 GCCAGAGTTCTTCAGGAACAT pLKO.1 2164 CDS 100% 4.950 3.465 N ARHGAP17 n/a
10 TRCN0000286318 GCCAGAGTTCTTCAGGAACAT pLKO_005 2164 CDS 100% 4.950 3.465 N ARHGAP17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545876.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03526 pDONR223 100% 91.9% 91.8% None (many diffs) n/a
2 ccsbBroad304_03526 pLX_304 0% 91.9% 91.8% V5 (many diffs) n/a
3 TRCN0000474970 TTAAGGCAACATTGCCGTCATCAA pLX_317 18.5% 91.9% 91.8% V5 (many diffs) n/a
4 ccsbBroadEn_12159 pDONR223 100% 13.1% 13.1% None 1_2271del;2607A>T n/a
5 ccsbBroad304_12159 pLX_304 0% 13.1% 13.1% V5 1_2271del;2607A>T n/a
6 TRCN0000468465 CCGGTTGCCTCTAATGATAGTGAA pLX_317 58.6% 13.1% 13.1% V5 1_2271del;2607A>T n/a
Download CSV