Transcript: Human XM_011546190.3

PREDICTED: Homo sapiens protein FRG1B (LOC102724813), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC102724813 (102724813)
Length:
559
CDS:
86..544

Additional Resources:

NCBI RefSeq record:
XM_011546190.3
NBCI Gene record:
LOC102724813 (102724813)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011546190.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075009 CTGTGCTGAAAGAGAAACCAA pLKO.1 193 CDS 100% 3.000 1.500 Y FRG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011546190.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13507 pDONR223 100% 70.2% 57.3% None (many diffs) n/a
2 ccsbBroad304_13507 pLX_304 0% 70.2% 57.3% V5 (many diffs) n/a
3 TRCN0000475567 TTCGAAGTGTCGGAGGTTAAGAGA pLX_317 72.9% 70.2% 57.3% V5 (many diffs) n/a
4 ccsbBroadEn_00591 pDONR223 100% 35.1% 32.1% None (many diffs) n/a
5 ccsbBroad304_00591 pLX_304 0% 35.1% 32.1% V5 (many diffs) n/a
6 TRCN0000471935 TTCCGACCATTCAACCTACGAGGA pLX_317 7.9% 35.1% 32.1% V5 (many diffs) n/a
Download CSV