Transcript: Human XM_017000180.2

PREDICTED: Homo sapiens cholinergic receptor nicotinic beta 2 subunit (CHRNB2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHRNB2 (1141)
Length:
10381
CDS:
621..1619

Additional Resources:

NCBI RefSeq record:
XM_017000180.2
NBCI Gene record:
CHRNB2 (1141)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000180.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061223 CGTGGACATCACGTATGACTT pLKO.1 773 CDS 100% 4.950 6.930 N CHRNB2 n/a
2 TRCN0000438327 TTGTACCAGCCCAGGCAATAG pLKO_005 1842 3UTR 100% 10.800 8.640 N CHRNB2 n/a
3 TRCN0000061225 GAGTTTGACAACATGAAGAAA pLKO.1 538 5UTR 100% 5.625 3.938 N CHRNB2 n/a
4 TRCN0000061226 CTTCCTCTGGATCTTTGTCTT pLKO.1 1493 CDS 100% 4.950 3.465 N CHRNB2 n/a
5 TRCN0000437146 CTTTGGCACCATCGGCATGTT pLKO_005 1523 CDS 100% 4.950 2.970 N CHRNB2 n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 7196 3UTR 100% 4.950 2.475 Y ERAP2 n/a
7 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 7249 3UTR 100% 4.050 2.025 Y LOC441087 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7197 3UTR 100% 13.200 6.600 Y LIAS n/a
9 TRCN0000436092 ATGTGGTCCTGTACAACAATG pLKO_005 593 5UTR 100% 10.800 15.120 N CHRNB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000180.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00309 pDONR223 100% 66.1% 66.1% None 0_1ins510 n/a
2 ccsbBroad304_00309 pLX_304 0% 66.1% 66.1% V5 0_1ins510 n/a
3 TRCN0000475738 TTTCACCCTCTCATCTATCGTTTA pLX_317 1.8% 66.1% 66.1% V5 0_1ins510 n/a
Download CSV