Transcript: Human XM_017000616.2

PREDICTED: Homo sapiens epidermal growth factor receptor pathway substrate 15 (EPS15), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPS15 (2060)
Length:
5079
CDS:
45..2642

Additional Resources:

NCBI RefSeq record:
XM_017000616.2
NBCI Gene record:
EPS15 (2060)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380496 GATTGGTGCAAATTGGCTAAA pLKO_005 3107 3UTR 100% 10.800 15.120 N EPS15 n/a
2 TRCN0000007979 CGACTAAATCAGCAGGAACAA pLKO.1 2568 CDS 100% 4.950 6.930 N EPS15 n/a
3 TRCN0000007976 CCTTCTGGAATATAGAGAAAT pLKO.1 2954 3UTR 100% 13.200 9.240 N EPS15 n/a
4 TRCN0000007977 GCAGCCAACAATAGCAGTATT pLKO.1 1977 CDS 100% 13.200 9.240 N EPS15 n/a
5 TRCN0000380400 TGGATTGGAGGTCCGTGAAAT pLKO_005 887 CDS 100% 13.200 9.240 N EPS15 n/a
6 TRCN0000380109 ACTCGACAATAATAGACATTC pLKO_005 1715 CDS 100% 10.800 7.560 N EPS15 n/a
7 TRCN0000379450 TGATCCTCCTCACGTTCTTAC pLKO_005 1046 CDS 100% 10.800 7.560 N EPS15 n/a
8 TRCN0000007980 CCCAGAATGGATTGGAAGTTT pLKO.1 292 CDS 100% 5.625 3.938 N EPS15 n/a
9 TRCN0000380542 GGAGAAGGAAGATACTATTAA pLKO_005 1226 CDS 100% 15.000 9.000 N EPS15 n/a
10 TRCN0000111723 CCATCAACAAATTGGATTCTT pLKO.1 2320 CDS 100% 5.625 3.938 N Eps15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13856 pDONR223 100% 87.9% 87.6% None (many diffs) n/a
2 ccsbBroad304_13856 pLX_304 0% 87.9% 87.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476753 CAACAATCCGAAGTTAAAACCTCC pLX_317 15.4% 87.9% 87.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV