Transcript: Human XM_017000636.2

PREDICTED: Homo sapiens estrogen related receptor gamma (ESRRG), transcript variant X25, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ESRRG (2104)
Length:
5543
CDS:
522..1850

Additional Resources:

NCBI RefSeq record:
XM_017000636.2
NBCI Gene record:
ESRRG (2104)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000636.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033646 CGGTCTCTTTCGTTTGAGGAT pLKO.1 1419 CDS 100% 2.640 3.696 N ESRRG n/a
2 TRCN0000222439 CGAGAGTTGGTGGTTATCATT pLKO.1 1293 CDS 100% 5.625 4.500 N Esrrg n/a
3 TRCN0000033645 CCTGTCAGGAAACTGTATGAT pLKO.1 738 CDS 100% 5.625 3.938 N ESRRG n/a
4 TRCN0000033647 CCTCACTACACTGTGTGACTT pLKO.1 1265 CDS 100% 4.950 3.465 N ESRRG n/a
5 TRCN0000033648 CGAATGAATGTGAAATCACAA pLKO.1 952 CDS 100% 4.950 3.465 N ESRRG n/a
6 TRCN0000033644 CCCTTATTTCTTTGCTTCTTT pLKO.1 2116 3UTR 100% 5.625 3.375 N ESRRG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000636.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10808 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_10808 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479885 GTCTCAAAGCGCGTTAGTGAGGAA pLX_317 30.6% 100% 100% V5 n/a
4 TRCN0000489295 TTTCACGAGATGAAAAACTTGAAA pLX_317 26% 99.9% 99.7% V5 1326_1327insG n/a
5 TRCN0000488884 ACTAGTAATCTGCAACAAAAACCT pLX_317 31.1% 98.3% 98.1% V5 (not translated due to prior stop codon) 632_652del;909G>A n/a
Download CSV