Construct: ORF TRCN0000492193
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020226.2_s317c1
- DNA Barcode:
- ACATCTCGAATCGGTTGGCTTTCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- FGR (2268)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492193
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | NM_001042729.2 | 100% | 100% | |
2 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | NM_001042747.1 | 100% | 100% | |
3 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | NM_005248.3 | 100% | 100% | |
4 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_006710452.2 | 100% | 100% | |
5 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_011541010.1 | 100% | 100% | |
6 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_011541011.2 | 86.9% | 82.6% | 226_227ins103;325_326ins104 |
7 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_011541012.2 | 77.5% | 70.1% | 1093_1094ins154;1230_1231ins203 |
8 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_011541013.3 | 66.5% | 64.6% | 1017_1018insGGCA;1056_1057ins527 |
9 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XR_946583.3 | 65.6% | 1_196del;1213_1214insGGCA;1780_2407del | |
10 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_011541014.3 | 61.4% | 61.4% | 0_1ins612 |
11 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_017000673.1 | 61.4% | 61.4% | 0_1ins612 |
12 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_017000674.1 | 61.4% | 61.4% | 0_1ins612 |
13 | mouse | 14191 | Fgr | FGR proto-oncogene, Src fam... | NM_010208.4 | 82.8% | 84.1% | (many diffs) |
14 | mouse | 14191 | Fgr | FGR proto-oncogene, Src fam... | XM_006538544.3 | 82.8% | 84.1% | (many diffs) |
15 | mouse | 14191 | Fgr | FGR proto-oncogene, Src fam... | XM_006538545.3 | 82.8% | 84.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1659
- ORF length:
- 1587
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgggctgt gtgttctgca agaaattgga gccggtggcc acggccaagg 121 aggatgctgg cctggaaggg gacttcagaa gctacggggc agcagaccac tatgggcctg 181 accccactaa ggcccggcct gcatcctcat ttgcccacat ccccaactac agcaacttct 241 cctctcaggc catcaaccct ggcttccttg atagtggcac catcaggggt gtgtcaggga 301 ttggggtgac cctgttcatt gccctgtatg actatgaggc tcgaactgag gatgacctca 361 ccttcaccaa gggcgagaag ttccacatcc tgaacaatac tgaaggtgac tggtgggagg 421 ctcggtctct cagctccgga aaaactggct gcattcccag caactacgtg gcccctgttg 481 actcaatcca agctgaagag tggtactttg gaaagattgg gagaaaggat gcagagaggc 541 agctgctttc accaggcaac ccccaggggg cctttctcat tcgggaaagc gagaccacca 601 aaggtgccta ctccctgtcc atccgggact gggatcagac cagaggcgat catgtgaagc 661 attacaagat ccgcaaactg gacatgggcg gctactacat caccacacgg gttcagttca 721 actcggtgca ggagctggtg cagcactaca tggaggtgaa tgacgggctg tgcaacctgc 781 tcatcgcgcc ctgcaccatc atgaagccgc agacgctggg cctggccaag gacgcctggg 841 agatcagccg cagctccatc acgctggagc gccggctggg caccggctgc ttcggggatg 901 tgtggctggg cacgtggaac ggcagcacta aggtggcggt gaagacgctg aagccgggca 961 ccatgtcccc gaaggccttc ctggaggagg cgcaggtcat gaagctgctg cggcacgaca 1021 agctggtgca gctgtacgcc gtggtgtcgg aggagcccat ctacatcgtg accgagttca 1081 tgtgtcacgg cagcttgctg gattttctca agaacccaga gggccaggat ttgaggctgc 1141 cccaattggt ggacatggca gcccaggtag ctgagggcat ggcctacatg gaacgcatga 1201 actacattca ccgcgacctg agggcagcca acatcctggt tggggagcgg ctggcgtgca 1261 agatcgcaga ctttggcttg gcgcgtctca tcaaggacga tgagtacaac ccctgccaag 1321 gttccaagtt ccccatcaag tggacagccc cagaagctgc cctctttggc agattcacca 1381 tcaagtcaga cgtgtggtcc tttgggatcc tgctcactga gctcatcacc aagggccgaa 1441 tcccctaccc aggcatgaat aaacgggaag tgttggaaca ggtggagcag ggcTACCACA 1501 TGCCGTGCCC TCCAGGCTGC CCAGCATCCC TGTACGAGGC CATGGAACAG ACCTGGCGTC 1561 TGGACCCGGA GGAGAGGCCT ACCTTCGAGT ACCTGCAGTC CTTCCTGGAG GACTACTTCA 1621 CCTCCGCTGA ACCACAGTAC CAGCCCGGGG ATCAGACATG AGACCCAGCT TTCTTGTACA 1681 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1741 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1801 AGGACGAACA TCTCGAATCG GTTGGCTTTC CACGCGTTAA GTCgacaatc aacctctgga 1861 ttacaaaatt tgtgaaagat t