Transcript: Human XM_017000696.2

PREDICTED: Homo sapiens WD repeat domain 47 (WDR47), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR47 (22911)
Length:
4033
CDS:
262..3042

Additional Resources:

NCBI RefSeq record:
XM_017000696.2
NBCI Gene record:
WDR47 (22911)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000696.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418414 GGCTAGTAACAATCGTTTATT pLKO_005 846 CDS 100% 15.000 21.000 N WDR47 n/a
2 TRCN0000415408 TGGACTAACCAGTCATGATAA pLKO_005 1248 CDS 100% 13.200 18.480 N WDR47 n/a
3 TRCN0000141310 CAGCAATGTAATGGGAGCAAA pLKO.1 1786 CDS 100% 4.950 6.930 N WDR47 n/a
4 TRCN0000140178 GCAAACTCTCTCCCTATCCAT pLKO.1 1148 CDS 100% 3.000 4.200 N WDR47 n/a
5 TRCN0000122412 GCCGAGTTTAAGGACTGGAAT pLKO.1 730 CDS 100% 4.950 3.960 N WDR47 n/a
6 TRCN0000140780 GCGGCAGATATACCAACAGAT pLKO.1 1620 CDS 100% 4.950 3.960 N WDR47 n/a
7 TRCN0000433204 ACATCATAAAGGATCCATTTA pLKO_005 2256 CDS 100% 13.200 9.240 N WDR47 n/a
8 TRCN0000142705 CAGGACCAGCTAAACAAGAAA pLKO.1 1508 CDS 100% 5.625 3.938 N WDR47 n/a
9 TRCN0000141658 CCACAGGTCAAGAAGATTCTA pLKO.1 2729 CDS 100% 5.625 3.938 N WDR47 n/a
10 TRCN0000144036 CCAGGTGTTCAGAATTACTTT pLKO.1 3468 3UTR 100% 5.625 3.938 N WDR47 n/a
11 TRCN0000141513 CCCAGGTGTTCAGAATTACTT pLKO.1 3467 3UTR 100% 5.625 3.938 N WDR47 n/a
12 TRCN0000144749 GCAGAATCTTACTGAACAGTT pLKO.1 1686 CDS 100% 4.950 3.465 N WDR47 n/a
13 TRCN0000122390 GCTGATAGGAAGCTAAGTGAA pLKO.1 814 CDS 100% 4.950 3.465 N WDR47 n/a
14 TRCN0000141586 CTTCAGTTCATTCAGCCTCTA pLKO.1 454 CDS 100% 4.050 2.835 N WDR47 n/a
15 TRCN0000417733 AGTCCTTGTGGGCAGTTATTA pLKO_005 2290 CDS 100% 15.000 9.000 N WDR47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000696.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07815 pDONR223 100% 98.9% 98.8% None (many diffs) n/a
2 ccsbBroad304_07815 pLX_304 0% 98.9% 98.8% V5 (many diffs) n/a
3 TRCN0000473175 TGCTCAGTTTTTTACCTACCTAGT pLX_317 6.5% 98.9% 98.8% V5 (many diffs) n/a
4 ccsbBroadEn_11648 pDONR223 100% 95.9% 95.7% None (many diffs) n/a
5 ccsbBroad304_11648 pLX_304 0% 95.9% 95.7% V5 (many diffs) n/a
6 TRCN0000471169 GTCCAGGACGTTTATTCGTGAGGT pLX_317 17.7% 95.9% 95.7% V5 (many diffs) n/a
Download CSV