Transcript: Human XM_017000853.2

PREDICTED: Homo sapiens integrin subunit beta 3 binding protein (ITGB3BP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITGB3BP (23421)
Length:
2031
CDS:
93..653

Additional Resources:

NCBI RefSeq record:
XM_017000853.2
NBCI Gene record:
ITGB3BP (23421)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000853.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296131 GTACAGGACTTCCTCACAAAG pLKO_005 556 CDS 100% 10.800 8.640 N ITGB3BP n/a
2 TRCN0000296109 ACTTGTCAAATGAGTCTATTT pLKO_005 204 CDS 100% 13.200 9.240 N ITGB3BP n/a
3 TRCN0000057737 GCACAGAAATGGACTATCAAA pLKO.1 254 CDS 100% 5.625 3.938 N ITGB3BP n/a
4 TRCN0000289037 GCACAGAAATGGACTATCAAA pLKO_005 254 CDS 100% 5.625 3.938 N ITGB3BP n/a
5 TRCN0000057734 CCCAGTTTAACTGAAAGCAAA pLKO.1 300 CDS 100% 4.950 3.465 N ITGB3BP n/a
6 TRCN0000057736 CCCACAAGTTCTGAAGAGCAA pLKO.1 231 CDS 100% 2.640 1.848 N ITGB3BP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000853.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02763 pDONR223 100% 88.6% 84.1% None (many diffs) n/a
2 ccsbBroad304_02763 pLX_304 0% 88.6% 84.1% V5 (many diffs) n/a
3 TRCN0000491686 CACATAGGCCCCTATATTCGGAAT pLX_317 77.2% 69.2% 67.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15760 pDONR223 0% 67.7% 63.5% None (many diffs) n/a
5 ccsbBroad304_15760 pLX_304 0% 67.7% 63.5% V5 (many diffs) n/a
Download CSV