Transcript: Human XM_017000961.2

PREDICTED: Homo sapiens neuronal growth regulator 1 (NEGR1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEGR1 (257194)
Length:
2479
CDS:
8..676

Additional Resources:

NCBI RefSeq record:
XM_017000961.2
NBCI Gene record:
NEGR1 (257194)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000961.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430905 GGCGGTGCTTAGGTGTTATTT pLKO_005 172 CDS 100% 15.000 21.000 N NEGR1 n/a
2 TRCN0000424294 GGCTGAACCGGTCAAGTATTA pLKO_005 219 CDS 100% 13.200 18.480 N NEGR1 n/a
3 TRCN0000148330 CCAACGTCACTCTTACTTGTT pLKO.1 468 CDS 100% 4.950 6.930 N NEGR1 n/a
4 TRCN0000146677 CTCAAATGATATGACCGTCAA pLKO.1 439 CDS 100% 4.050 5.670 N NEGR1 n/a
5 TRCN0000149430 CTCAACATACACCCAGAACAA pLKO.1 372 CDS 100% 4.950 3.465 N NEGR1 n/a
6 TRCN0000148043 GTTATTTGGAAGATGGAGCTT pLKO.1 186 CDS 100% 2.640 1.848 N NEGR1 n/a
7 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 1496 3UTR 100% 4.950 2.475 Y NPHS1 n/a
8 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1658 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000961.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13482 pDONR223 100% 26.5% 26.5% None 1_384del;666_667ins396 n/a
2 ccsbBroad304_13482 pLX_304 0% 26.5% 26.5% V5 1_384del;666_667ins396 n/a
3 TRCN0000475198 CATTAACTGAATTATCAAAAGAAC pLX_317 79.9% 26.5% 26.5% V5 1_384del;666_667ins396 n/a
Download CSV