Transcript: Human XM_017001204.1

PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 2 (IL12RB2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL12RB2 (3595)
Length:
2446
CDS:
742..2238

Additional Resources:

NCBI RefSeq record:
XM_017001204.1
NBCI Gene record:
IL12RB2 (3595)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001204.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436750 TACGGAGTCGACCCTACAATG pLKO_005 2162 CDS 100% 10.800 15.120 N IL12RB2 n/a
2 TRCN0000413042 TTCCAGACGTAACAAGTTAAT pLKO_005 927 CDS 100% 13.200 9.240 N IL12RB2 n/a
3 TRCN0000058158 CCTGTATCAATAGTGATGAAA pLKO.1 1052 CDS 100% 5.625 3.938 N IL12RB2 n/a
4 TRCN0000058160 CCCACTTATACACTGAGTATA pLKO.1 1193 CDS 100% 1.320 0.924 N IL12RB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001204.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491277 ATCCTAACGTAATTTTTTAATGAC pLX_317 10.6% 57.1% 56.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_06446 pDONR223 100% 57.1% 56.4% None (many diffs) n/a
3 ccsbBroad304_06446 pLX_304 0% 57.1% 56.4% V5 (many diffs) n/a
4 TRCN0000481116 AATCCCCGCATTTGGATCTGTTCC pLX_317 14.6% 57.1% 56.4% V5 (many diffs) n/a
Download CSV