Transcript: Human XM_017001387.2

PREDICTED: Homo sapiens WD repeat containing, antisense to TP73 (WRAP73), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WRAP73 (49856)
Length:
1636
CDS:
67..1428

Additional Resources:

NCBI RefSeq record:
XM_017001387.2
NBCI Gene record:
WRAP73 (49856)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001387.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129475 GCATTTAAGCGGAGACTCGAT pLKO.1 1314 CDS 100% 2.640 3.696 N WRAP73 n/a
2 TRCN0000330541 CGACAAGGAACGACAACATTC pLKO_005 1082 CDS 100% 10.800 8.640 N WRAP73 n/a
3 TRCN0000129903 GCCATTAATGATCCCAAGATA pLKO.1 862 CDS 100% 5.625 3.938 N WRAP73 n/a
4 TRCN0000353682 GCCATTAATGATCCCAAGATA pLKO_005 862 CDS 100% 5.625 3.938 N WRAP73 n/a
5 TRCN0000129269 CTCCAGCTTACTCTGCAAGTT pLKO.1 93 CDS 100% 4.950 3.465 N WRAP73 n/a
6 TRCN0000330539 CTCCAGCTTACTCTGCAAGTT pLKO_005 93 CDS 100% 4.950 3.465 N WRAP73 n/a
7 TRCN0000330542 TGCAGAAACAGGGCTACTCTG pLKO_005 1447 3UTR 100% 4.050 2.835 N WRAP73 n/a
8 TRCN0000129630 CAAAGATTACGTGAGCATCTT pLKO.1 534 CDS 100% 0.495 0.347 N WRAP73 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001387.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03140 pDONR223 100% 98.4% 98.2% None 922_923ins21 n/a
2 ccsbBroad304_03140 pLX_304 0% 98.4% 98.2% V5 922_923ins21 n/a
3 TRCN0000480340 TAGCGTTCTGGATAAGCGCTCGAC pLX_317 31.5% 98.4% 98.2% V5 922_923ins21 n/a
4 ccsbBroadEn_15811 pDONR223 0% 91.3% 88.2% None (many diffs) n/a
5 ccsbBroad304_15811 pLX_304 0% 91.3% 88.2% V5 (many diffs) n/a
6 TRCN0000473493 GCCACTGTCGCGGTGAAATGTGAT pLX_317 19.1% 91.3% 88.2% V5 (many diffs) n/a
Download CSV