Transcript: Human XM_017001594.2

PREDICTED: Homo sapiens protein phosphatase 1 regulatory subunit 8 (PPP1R8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP1R8 (5511)
Length:
1947
CDS:
474..857

Additional Resources:

NCBI RefSeq record:
XM_017001594.2
NBCI Gene record:
PPP1R8 (5511)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001594.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218076 TCCCACTTTCTAGGATCATTT pLKO_005 1137 3UTR 100% 13.200 18.480 N PPP1R8 n/a
2 TRCN0000226411 TGCCGTCAGCAGTGAACATGA pLKO_005 721 CDS 100% 4.950 6.930 N PPP1R8 n/a
3 TRCN0000226412 TATAACCCTGAAGCTGTAAAT pLKO_005 765 CDS 100% 13.200 10.560 N PPP1R8 n/a
4 TRCN0000226413 TTCCTTGCTGATTTGATATTT pLKO_005 842 CDS 100% 15.000 10.500 N PPP1R8 n/a
5 TRCN0000002474 CCACACCTTCCTTGCTGATTT pLKO.1 835 CDS 100% 13.200 9.240 N PPP1R8 n/a
6 TRCN0000226410 TTGCCCATGCCATACCCAAAC pLKO_005 669 CDS 100% 6.000 4.200 N PPP1R8 n/a
7 TRCN0000002473 GAACATGAACCCTGCACCAAA pLKO.1 734 CDS 100% 4.950 3.465 N PPP1R8 n/a
8 TRCN0000002476 TGTAAATGAACCCAAGAAGAA pLKO.1 779 CDS 100% 4.950 3.465 N PPP1R8 n/a
9 TRCN0000002475 CATAGGAGACAAAGTTAGGAA pLKO.1 1799 3UTR 100% 3.000 2.100 N PPP1R8 n/a
10 TRCN0000002472 TGAAGCTGTAAATGAACCCAA pLKO.1 773 CDS 100% 2.640 1.848 N PPP1R8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001594.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01261 pDONR223 100% 60.7% 60.7% None 0_1ins246 n/a
2 ccsbBroad304_01261 pLX_304 0% 60.7% 60.7% V5 0_1ins246 n/a
3 TRCN0000465265 TCGCCCCGCTTATTGGGACAGCGC pLX_317 39.2% 60.7% 60.7% V5 0_1ins246 n/a
Download CSV